Incidental Mutation 'R2002:Snap29'
ID223258
Institutional Source Beutler Lab
Gene Symbol Snap29
Ensembl Gene ENSMUSG00000022765
Gene Namesynaptosomal-associated protein 29
Synonyms1300018G05Rik
MMRRC Submission 040012-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.340) question?
Stock #R2002 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location17405986-17430827 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 17406326 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 68 (Y68*)
Ref Sequence ENSEMBL: ENSMUSP00000023449 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023449] [ENSMUST00000036161] [ENSMUST00000232232]
Predicted Effect probably null
Transcript: ENSMUST00000023449
AA Change: Y68*
SMART Domains Protein: ENSMUSP00000023449
Gene: ENSMUSG00000022765
AA Change: Y68*

DomainStartEndE-ValueType
t_SNARE 45 112 1.53e-6 SMART
t_SNARE 193 260 1.39e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000036161
SMART Domains Protein: ENSMUSP00000036162
Gene: ENSMUSG00000041720

DomainStartEndE-ValueType
low complexity region 198 221 N/A INTRINSIC
low complexity region 243 253 N/A INTRINSIC
SCOP:d1gw5a_ 268 675 2e-3 SMART
low complexity region 895 907 N/A INTRINSIC
PI3Ka 1483 1671 2.11e-54 SMART
Blast:PI3Kc 1688 1762 2e-39 BLAST
PI3Kc 1788 2041 4.04e-106 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128938
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231419
Predicted Effect probably benign
Transcript: ENSMUST00000232232
Meta Mutation Damage Score 0.6244 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 91.6%
Validation Efficiency 97% (72/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene, a member of the SNAP25 gene family, encodes a protein involved in multiple membrane trafficking steps. Two other members of this gene family, SNAP23 and SNAP25, encode proteins that bind a syntaxin protein and mediate synaptic vesicle membrane docking and fusion to the plasma membrane. The protein encoded by this gene binds tightly to multiple syntaxins and is localized to intracellular membrane structures rather than to the plasma membrane. While the protein is mostly membrane-bound, a significant fraction of it is found free in the cytoplasm. Use of multiple polyadenylation sites has been noted for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit slightly reduced birth body size and a congenital ichtyotic phenotype associated with scaly and tight skin, hyperkeratosis, acanthosis, abnormalities in epidermal differentiation and autophagy, and increased endoplasmic reticulum stress. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930548G14Rik T C 15: 46,625,606 noncoding transcript Het
Abcb4 T A 5: 8,905,989 S98T probably benign Het
Acan T C 7: 79,100,793 S1771P probably damaging Het
Acvr1c T A 2: 58,315,975 Q41L probably benign Het
Ak2 T A 4: 129,008,229 S232T probably benign Het
Akr1e1 T A 13: 4,607,565 probably benign Het
Ano7 T C 1: 93,400,581 probably benign Het
Aox1 T A 1: 58,047,141 H68Q possibly damaging Het
Apaf1 A G 10: 91,061,814 V269A possibly damaging Het
Apba2 A T 7: 64,733,542 I368F probably damaging Het
Armc3 A G 2: 19,288,936 M513V probably benign Het
Asb5 G A 8: 54,583,620 V116M probably damaging Het
Atg16l2 A G 7: 101,294,920 S280P possibly damaging Het
Atp6v0c G T 17: 24,164,861 T40K probably damaging Het
C330027C09Rik T C 16: 49,005,851 probably benign Het
Cdk2ap2 A G 19: 4,097,903 M57V possibly damaging Het
Ctnnd1 T C 2: 84,620,360 N172S probably benign Het
Ddx55 T A 5: 124,566,440 V370E probably damaging Het
Ddx6 A G 9: 44,607,534 T48A probably benign Het
Dnah10 C T 5: 124,833,988 R4490W probably damaging Het
Dspp T A 5: 104,178,559 S929R unknown Het
Erbb3 T C 10: 128,586,225 Y50C probably benign Het
Fam209 C A 2: 172,472,769 N59K probably benign Het
Fgd3 T C 13: 49,296,455 E106G probably benign Het
Frmd4a A C 2: 4,572,365 K344T probably damaging Het
Gbe1 A G 16: 70,528,926 E617G probably damaging Het
Gm5089 T A 14: 122,436,274 I12F unknown Het
Gm7052 T A 17: 22,039,939 probably benign Het
Gria1 A T 11: 57,012,104 N24I possibly damaging Het
Grin2b T C 6: 135,733,245 E1101G probably damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Kcnma1 A C 14: 23,337,029 S982A probably damaging Het
Khdrbs3 T A 15: 69,013,479 probably benign Het
Kif23 A T 9: 61,927,384 C426* probably null Het
Lmo7 G T 14: 101,887,061 A319S probably benign Het
Ly6c1 T A 15: 75,048,493 T7S possibly damaging Het
Magel2 G A 7: 62,379,096 V583I unknown Het
Mamdc4 A T 2: 25,567,232 W548R probably damaging Het
Mfsd2a C T 4: 122,956,816 R88Q probably damaging Het
Mkrn1 T C 6: 39,405,803 T158A probably benign Het
Mroh2b G T 15: 4,925,684 D720Y probably damaging Het
Mycbp2 A G 14: 103,248,403 V1041A probably damaging Het
Ncam2 A T 16: 81,589,698 H655L possibly damaging Het
Npas2 T C 1: 39,338,195 V546A probably benign Het
Nrxn3 G A 12: 90,332,315 A400T probably damaging Het
Olfr1020 T A 2: 85,850,400 V316E probably benign Het
Olfr1066 T C 2: 86,455,473 H266R probably benign Het
Olfr139 A T 11: 74,045,039 S78R possibly damaging Het
Oog3 G T 4: 144,158,105 H420Q possibly damaging Het
Pak7 T A 2: 136,116,637 H177L probably benign Het
Pcca A G 14: 122,887,065 I683V probably benign Het
Pea15a T C 1: 172,198,685 I90V probably benign Het
Plagl1 C A 10: 13,128,658 probably benign Het
Prmt1 A G 7: 44,978,724 V237A probably damaging Het
Ptprz1 T A 6: 23,027,834 Y910* probably null Het
Rasal3 T A 17: 32,393,611 T757S probably damaging Het
Rbbp8 T C 18: 11,727,166 probably benign Het
S1pr1 A G 3: 115,712,895 S17P probably benign Het
Scel G A 14: 103,541,985 V131M probably damaging Het
Scn2a G A 2: 65,682,083 R188Q probably null Het
Spdl1 T C 11: 34,822,646 T199A probably benign Het
Srbd1 T C 17: 86,142,400 N14D probably benign Het
Ston1 G A 17: 88,635,529 G121D probably benign Het
Syt16 G A 12: 74,235,203 G367E possibly damaging Het
Tdpoz1 T C 3: 93,671,403 T25A possibly damaging Het
Tmem182 T A 1: 40,806,195 Y77N probably damaging Het
Tmprss11f A T 5: 86,539,768 probably benign Het
Trp73 T C 4: 154,081,445 T56A probably damaging Het
Trpm3 A G 19: 22,982,583 K1194R probably damaging Het
Ttc39c T A 18: 12,697,878 probably null Het
Ube4b T C 4: 149,383,797 D174G probably benign Het
Vmn1r211 A T 13: 22,851,783 M238K probably damaging Het
Wsb2 T A 5: 117,370,733 N77K probably benign Het
Xkr4 C T 1: 3,671,095 R85Q probably benign Het
Zmynd11 T A 13: 9,689,478 probably null Het
Other mutations in Snap29
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03231:Snap29 APN 16 17427100 missense probably benign 0.06
IGL02799:Snap29 UTSW 16 17422503 missense probably benign
R0086:Snap29 UTSW 16 17428236 missense probably damaging 0.96
R0371:Snap29 UTSW 16 17406203 missense probably benign 0.02
R0616:Snap29 UTSW 16 17422506 nonsense probably null
R0709:Snap29 UTSW 16 17406148 missense probably damaging 0.99
R2137:Snap29 UTSW 16 17428249 missense possibly damaging 0.60
R4478:Snap29 UTSW 16 17428155 missense probably benign 0.00
R4976:Snap29 UTSW 16 17419268 missense probably damaging 1.00
R5933:Snap29 UTSW 16 17406330 missense probably damaging 1.00
R6314:Snap29 UTSW 16 17419319 missense probably benign 0.25
R6824:Snap29 UTSW 16 17422506 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GTCTGGCTATCCTAAAAGCTATAATCC -3'
(R):5'- TTCCAGAGGTAAACATCAGGTGATC -3'

Sequencing Primer
(F):5'- GCTATAATCCTTTCGACGATGACG -3'
(R):5'- GTCCATGAACTTACGGTAGG -3'
Posted On2014-08-25