Incidental Mutation 'R2002:C330027C09Rik'
ID223260
Institutional Source Beutler Lab
Gene Symbol C330027C09Rik
Ensembl Gene ENSMUSG00000033031
Gene NameRIKEN cDNA C330027C09 gene
SynonymsCip2a
MMRRC Submission 040012-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.888) question?
Stock #R2002 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location48994185-49019709 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 49005851 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000113075 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048374] [ENSMUST00000117994] [ENSMUST00000125278]
Predicted Effect probably benign
Transcript: ENSMUST00000048374
SMART Domains Protein: ENSMUSP00000044714
Gene: ENSMUSG00000033031

DomainStartEndE-ValueType
SCOP:d1jdha_ 47 309 3e-4 SMART
low complexity region 439 450 N/A INTRINSIC
coiled coil region 635 887 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117994
SMART Domains Protein: ENSMUSP00000113075
Gene: ENSMUSG00000033031

DomainStartEndE-ValueType
SCOP:d1jdha_ 47 309 2e-4 SMART
low complexity region 439 450 N/A INTRINSIC
coiled coil region 635 887 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123975
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125278
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127995
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130080
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 91.6%
Validation Efficiency 97% (72/74)
MGI Phenotype PHENOTYPE: Mice homozygous for a hypomorphic allele display oligozoospermia, small epididymis and impaired spermatogonial progenitor cell maintenance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930548G14Rik T C 15: 46,625,606 noncoding transcript Het
Abcb4 T A 5: 8,905,989 S98T probably benign Het
Acan T C 7: 79,100,793 S1771P probably damaging Het
Acvr1c T A 2: 58,315,975 Q41L probably benign Het
Ak2 T A 4: 129,008,229 S232T probably benign Het
Akr1e1 T A 13: 4,607,565 probably benign Het
Ano7 T C 1: 93,400,581 probably benign Het
Aox1 T A 1: 58,047,141 H68Q possibly damaging Het
Apaf1 A G 10: 91,061,814 V269A possibly damaging Het
Apba2 A T 7: 64,733,542 I368F probably damaging Het
Armc3 A G 2: 19,288,936 M513V probably benign Het
Asb5 G A 8: 54,583,620 V116M probably damaging Het
Atg16l2 A G 7: 101,294,920 S280P possibly damaging Het
Atp6v0c G T 17: 24,164,861 T40K probably damaging Het
Cdk2ap2 A G 19: 4,097,903 M57V possibly damaging Het
Ctnnd1 T C 2: 84,620,360 N172S probably benign Het
Ddx55 T A 5: 124,566,440 V370E probably damaging Het
Ddx6 A G 9: 44,607,534 T48A probably benign Het
Dnah10 C T 5: 124,833,988 R4490W probably damaging Het
Dspp T A 5: 104,178,559 S929R unknown Het
Erbb3 T C 10: 128,586,225 Y50C probably benign Het
Fam209 C A 2: 172,472,769 N59K probably benign Het
Fgd3 T C 13: 49,296,455 E106G probably benign Het
Frmd4a A C 2: 4,572,365 K344T probably damaging Het
Gbe1 A G 16: 70,528,926 E617G probably damaging Het
Gm5089 T A 14: 122,436,274 I12F unknown Het
Gm7052 T A 17: 22,039,939 probably benign Het
Gria1 A T 11: 57,012,104 N24I possibly damaging Het
Grin2b T C 6: 135,733,245 E1101G probably damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Kcnma1 A C 14: 23,337,029 S982A probably damaging Het
Khdrbs3 T A 15: 69,013,479 probably benign Het
Kif23 A T 9: 61,927,384 C426* probably null Het
Lmo7 G T 14: 101,887,061 A319S probably benign Het
Ly6c1 T A 15: 75,048,493 T7S possibly damaging Het
Magel2 G A 7: 62,379,096 V583I unknown Het
Mamdc4 A T 2: 25,567,232 W548R probably damaging Het
Mfsd2a C T 4: 122,956,816 R88Q probably damaging Het
Mkrn1 T C 6: 39,405,803 T158A probably benign Het
Mroh2b G T 15: 4,925,684 D720Y probably damaging Het
Mycbp2 A G 14: 103,248,403 V1041A probably damaging Het
Ncam2 A T 16: 81,589,698 H655L possibly damaging Het
Npas2 T C 1: 39,338,195 V546A probably benign Het
Nrxn3 G A 12: 90,332,315 A400T probably damaging Het
Olfr1020 T A 2: 85,850,400 V316E probably benign Het
Olfr1066 T C 2: 86,455,473 H266R probably benign Het
Olfr139 A T 11: 74,045,039 S78R possibly damaging Het
Oog3 G T 4: 144,158,105 H420Q possibly damaging Het
Pak7 T A 2: 136,116,637 H177L probably benign Het
Pcca A G 14: 122,887,065 I683V probably benign Het
Pea15a T C 1: 172,198,685 I90V probably benign Het
Plagl1 C A 10: 13,128,658 probably benign Het
Prmt1 A G 7: 44,978,724 V237A probably damaging Het
Ptprz1 T A 6: 23,027,834 Y910* probably null Het
Rasal3 T A 17: 32,393,611 T757S probably damaging Het
Rbbp8 T C 18: 11,727,166 probably benign Het
S1pr1 A G 3: 115,712,895 S17P probably benign Het
Scel G A 14: 103,541,985 V131M probably damaging Het
Scn2a G A 2: 65,682,083 R188Q probably null Het
Snap29 T A 16: 17,406,326 Y68* probably null Het
Spdl1 T C 11: 34,822,646 T199A probably benign Het
Srbd1 T C 17: 86,142,400 N14D probably benign Het
Ston1 G A 17: 88,635,529 G121D probably benign Het
Syt16 G A 12: 74,235,203 G367E possibly damaging Het
Tdpoz1 T C 3: 93,671,403 T25A possibly damaging Het
Tmem182 T A 1: 40,806,195 Y77N probably damaging Het
Tmprss11f A T 5: 86,539,768 probably benign Het
Trp73 T C 4: 154,081,445 T56A probably damaging Het
Trpm3 A G 19: 22,982,583 K1194R probably damaging Het
Ttc39c T A 18: 12,697,878 probably null Het
Ube4b T C 4: 149,383,797 D174G probably benign Het
Vmn1r211 A T 13: 22,851,783 M238K probably damaging Het
Wsb2 T A 5: 117,370,733 N77K probably benign Het
Xkr4 C T 1: 3,671,095 R85Q probably benign Het
Zmynd11 T A 13: 9,689,478 probably null Het
Other mutations in C330027C09Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:C330027C09Rik APN 16 49001815 missense probably damaging 1.00
IGL00788:C330027C09Rik APN 16 49009069 splice site probably benign
IGL01343:C330027C09Rik APN 16 49013188 missense probably damaging 1.00
IGL01348:C330027C09Rik APN 16 49013188 missense probably damaging 1.00
IGL01876:C330027C09Rik APN 16 49001678 missense probably damaging 1.00
IGL02255:C330027C09Rik APN 16 49010813 missense probably damaging 0.99
IGL02515:C330027C09Rik APN 16 49005733 missense possibly damaging 0.47
IGL03295:C330027C09Rik APN 16 48994341 missense probably damaging 1.00
R0020:C330027C09Rik UTSW 16 49001612 missense probably damaging 1.00
R0020:C330027C09Rik UTSW 16 49001612 missense probably damaging 1.00
R0031:C330027C09Rik UTSW 16 49017373 missense probably benign 0.14
R0612:C330027C09Rik UTSW 16 48999039 missense probably benign 0.04
R1187:C330027C09Rik UTSW 16 49000293 missense probably damaging 1.00
R1707:C330027C09Rik UTSW 16 49018404 missense probably damaging 1.00
R1711:C330027C09Rik UTSW 16 49017486 missense probably benign 0.31
R1715:C330027C09Rik UTSW 16 49005719 missense probably benign 0.18
R2000:C330027C09Rik UTSW 16 49014969 missense probably damaging 0.99
R2360:C330027C09Rik UTSW 16 49017465 nonsense probably null
R4093:C330027C09Rik UTSW 16 49000976 splice site probably benign
R4292:C330027C09Rik UTSW 16 49013249 missense probably benign 0.00
R4293:C330027C09Rik UTSW 16 49013249 missense probably benign 0.00
R4295:C330027C09Rik UTSW 16 49013249 missense probably benign 0.00
R4726:C330027C09Rik UTSW 16 49014070 missense probably benign 0.02
R4925:C330027C09Rik UTSW 16 49016363 critical splice donor site probably null
R5735:C330027C09Rik UTSW 16 49017493 critical splice donor site probably null
R5893:C330027C09Rik UTSW 16 48997500 missense probably benign
R6146:C330027C09Rik UTSW 16 48994329 nonsense probably null
R6649:C330027C09Rik UTSW 16 49017466 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTGAAAGCTGGCTAAAATGC -3'
(R):5'- GAACCACAGTCCATATACTTTGAGC -3'

Sequencing Primer
(F):5'- TCTGAAAGCTGGCTAAAATGCTAAAG -3'
(R):5'- ACCTTTTCATGTGGCAGCTG -3'
Posted On2014-08-25