Incidental Mutation 'R2018:Olfr1245'
ID223355
Institutional Source Beutler Lab
Gene Symbol Olfr1245
Ensembl Gene ENSMUSG00000111456
Gene Nameolfactory receptor 1245
SynonymsGA_x6K02T2Q125-51020951-51020028, MOR231-12
MMRRC Submission 040027-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.109) question?
Stock #R2018 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location89573406-89578447 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 89575393 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 111 (V111A)
Gene Model predicted gene model for transcript(s): [ENSMUST00000214870] [ENSMUST00000217402]
Predicted Effect probably damaging
Transcript: ENSMUST00000099766
AA Change: V111A

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000097354
Gene: ENSMUSG00000100601
AA Change: V111A

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 6e-49 PFAM
Pfam:7tm_1 39 285 2.8e-17 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000099773
AA Change: V111A

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000097361
Gene: ENSMUSG00000075083
AA Change: V111A

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 3.2e-48 PFAM
Pfam:7tm_1 39 285 3e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214870
AA Change: V111A

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
Predicted Effect probably damaging
Transcript: ENSMUST00000217402
AA Change: V111A

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
Meta Mutation Damage Score 0.0284 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.9%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 111 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610028H24Rik C A 10: 76,458,065 F252L possibly damaging Het
4921501E09Rik T C 17: 33,066,967 N287S probably benign Het
4930447A16Rik T G 15: 37,440,498 probably benign Het
Abca14 A T 7: 120,216,185 M219L probably benign Het
Abi3bp A G 16: 56,677,796 T918A probably damaging Het
Acss3 C T 10: 106,936,207 S669N probably benign Het
Adamts16 G A 13: 70,779,518 probably benign Het
Adamtsl4 A G 3: 95,681,102 Y559H probably damaging Het
Adgrg5 T A 8: 94,934,480 M106K probably damaging Het
Akt1 T C 12: 112,659,625 N71S probably damaging Het
Amer2 A C 14: 60,378,445 K30Q probably damaging Het
Anapc5 T C 5: 122,800,524 K383E probably damaging Het
Ano1 A G 7: 144,654,250 L258P probably damaging Het
Arhgef10l A G 4: 140,544,384 S560P probably damaging Het
Arhgef40 T A 14: 52,003,705 L1395Q probably damaging Het
Arid1a A T 4: 133,681,834 D1787E unknown Het
C77080 A G 4: 129,222,355 S884P probably damaging Het
Ces2h T C 8: 105,018,398 L388P probably damaging Het
Cfap54 T A 10: 93,016,604 N880I probably benign Het
Cryz T C 3: 154,621,683 V116A probably damaging Het
Csrp1 G A 1: 135,750,628 A159T probably damaging Het
Cttnbp2 A G 6: 18,434,518 F447S probably damaging Het
Cyp4a12a A T 4: 115,327,505 I328F probably damaging Het
Cyth4 T G 15: 78,608,171 H133Q probably damaging Het
Ddah2 A G 17: 35,060,426 I88V possibly damaging Het
Dmbt1 T G 7: 131,110,989 I1563S possibly damaging Het
Dnajc22 T C 15: 99,101,233 S100P probably benign Het
Fam172a A G 13: 77,999,637 T321A possibly damaging Het
Fancl T A 11: 26,422,459 D123E probably damaging Het
Fbxo30 A G 10: 11,291,028 Q498R probably damaging Het
Fgd4 T C 16: 16,435,960 H581R probably benign Het
Gm2663 T C 6: 40,997,966 Q57R probably benign Het
Gm5065 A G 7: 5,359,574 D68G probably benign Het
Gm7247 A T 14: 51,365,347 M47L possibly damaging Het
Gsdmc2 T A 15: 63,828,126 probably null Het
Hc A C 2: 35,013,528 F1038C probably damaging Het
Heatr1 C A 13: 12,414,478 Q890K possibly damaging Het
Hipk4 C A 7: 27,529,004 T293K probably damaging Het
Hp1bp3 C A 4: 138,221,632 A2E probably damaging Het
Il6 T C 5: 30,014,947 probably null Het
Itga6 A G 2: 71,818,484 D104G probably benign Het
Krt24 A G 11: 99,282,451 S293P probably damaging Het
Krt4 C T 15: 101,920,651 R309Q probably damaging Het
Krt40 A T 11: 99,540,087 W199R probably damaging Het
Lamc1 T C 1: 153,242,632 E931G probably benign Het
Lamp3 A T 16: 19,701,211 M74K probably benign Het
Magel2 G A 7: 62,379,096 V583I unknown Het
March7 T A 2: 60,229,040 Y37* probably null Het
Mrpl36 A G 13: 73,331,568 K66E probably damaging Het
Mrps35 G T 6: 147,061,484 E229* probably null Het
Mtmr6 T C 14: 60,298,992 M557T probably benign Het
Myocd A T 11: 65,187,028 I647N probably damaging Het
Myom2 A C 8: 15,131,151 L1350F probably damaging Het
Nosip T A 7: 45,076,609 S197T probably benign Het
Npat A G 9: 53,562,491 K528E probably benign Het
Nyap2 A G 1: 81,191,872 T115A probably benign Het
Olfr1032 A T 2: 86,008,223 Y149F probably damaging Het
Olfr1214 G T 2: 88,988,145 P19Q probably benign Het
Olfr122 A G 17: 37,772,576 R317G probably benign Het
Olfr65 T A 7: 103,907,042 V201D possibly damaging Het
Olfr972 A G 9: 39,874,058 Q261R probably benign Het
Orc1 T C 4: 108,590,700 V48A possibly damaging Het
Pde6d T C 1: 86,546,716 E69G probably damaging Het
Pdgfrb A T 18: 61,083,334 D1088V possibly damaging Het
Peg12 A G 7: 62,463,638 V237A probably benign Het
Piezo1 A G 8: 122,482,712 F2371L probably benign Het
Podn T A 4: 108,023,373 S27C probably damaging Het
Pom121l2 A G 13: 21,982,734 M392V possibly damaging Het
Ppm1b A G 17: 84,994,202 K170R probably damaging Het
Rab18 A T 18: 6,770,113 probably null Het
Raet1d G A 10: 22,371,012 A80T probably damaging Het
Rfx7 T A 9: 72,617,685 V719E probably benign Het
Rnf219 T A 14: 104,522,542 K24M probably damaging Het
Ror1 C T 4: 100,407,841 Q171* probably null Het
Rufy4 G A 1: 74,140,947 V454M possibly damaging Het
Ryr2 C T 13: 11,851,188 G292D possibly damaging Het
Ryr3 G T 2: 112,781,065 N2257K probably benign Het
Saal1 A G 7: 46,699,489 F306S possibly damaging Het
Sap18 A G 14: 57,798,564 N69S probably damaging Het
Sar1b A T 11: 51,779,687 probably null Het
Serpina3n G T 12: 104,409,214 V182L probably damaging Het
Setd3 A T 12: 108,118,254 H279Q probably damaging Het
Slc18a2 C A 19: 59,276,505 A307E possibly damaging Het
Slc4a10 A T 2: 62,234,381 D193V probably damaging Het
Spire2 T C 8: 123,332,918 C52R probably damaging Het
Syne2 A T 12: 76,074,579 I5940F probably damaging Het
Sytl1 C T 4: 133,256,160 S355N probably damaging Het
Tarbp1 C T 8: 126,428,114 V1424I probably damaging Het
Tatdn3 A T 1: 191,049,280 probably null Het
Tbpl1 T A 10: 22,707,677 E131D probably damaging Het
Telo2 A T 17: 25,105,408 M501K probably damaging Het
Terb1 A G 8: 104,452,699 V619A probably benign Het
Tmem132e A G 11: 82,445,163 T1024A probably benign Het
Tmem30a T C 9: 79,774,218 D223G probably damaging Het
Tmprss11d A G 5: 86,339,554 V19A probably damaging Het
Tnks A T 8: 34,851,106 S872T probably damaging Het
Tnxb A G 17: 34,671,750 S356G probably benign Het
Tob2 T C 15: 81,851,199 K190E probably damaging Het
Togaram1 T C 12: 65,002,659 V1240A possibly damaging Het
Trim13 T A 14: 61,604,886 C117* probably null Het
Trpv4 G A 5: 114,634,605 R308C probably damaging Het
Ttn C G 2: 76,755,332 D21987H probably damaging Het
Ttn C A 2: 76,826,074 probably null Het
Upp1 A T 11: 9,133,240 M111L possibly damaging Het
Vmn1r206 A T 13: 22,620,188 V283E probably damaging Het
Vmn2r79 G T 7: 87,002,426 L344F probably benign Het
Vmn2r93 T G 17: 18,326,062 I732S probably damaging Het
Vmn2r96 G T 17: 18,584,001 M504I probably benign Het
Vps39 T C 2: 120,343,227 Y147C probably damaging Het
Zbtb20 T A 16: 43,577,652 C35S possibly damaging Het
Zfp871 A T 17: 32,774,777 C475S probably damaging Het
Other mutations in Olfr1245
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01122:Olfr1245 APN 2 89575423 missense possibly damaging 0.68
IGL01690:Olfr1245 APN 2 89575213 missense probably benign 0.09
IGL02334:Olfr1245 APN 2 89575324 missense possibly damaging 0.95
IGL02435:Olfr1245 APN 2 89575546 missense probably damaging 0.99
IGL02793:Olfr1245 APN 2 89575552 missense probably damaging 1.00
IGL02875:Olfr1245 APN 2 89575552 missense probably damaging 1.00
IGL03218:Olfr1245 APN 2 89575591 missense probably benign 0.09
IGL03392:Olfr1245 APN 2 89575249 missense probably damaging 0.96
H8786:Olfr1245 UTSW 2 89575279 missense probably damaging 1.00
I0000:Olfr1245 UTSW 2 89575153 missense probably damaging 1.00
R0044:Olfr1245 UTSW 2 89575630 missense possibly damaging 0.68
R0190:Olfr1245 UTSW 2 89574958 missense probably damaging 0.98
R1585:Olfr1245 UTSW 2 89575402 missense possibly damaging 0.89
R1902:Olfr1245 UTSW 2 89575603 missense possibly damaging 0.77
R2019:Olfr1245 UTSW 2 89575393 missense probably damaging 0.97
R2020:Olfr1245 UTSW 2 89574961 missense possibly damaging 0.88
R2021:Olfr1245 UTSW 2 89574961 missense possibly damaging 0.88
R2030:Olfr1245 UTSW 2 89575214 missense probably benign 0.00
R2133:Olfr1245 UTSW 2 89575256 nonsense probably null
R3850:Olfr1245 UTSW 2 89575034 missense probably damaging 0.99
R4066:Olfr1245 UTSW 2 89575179 missense probably damaging 1.00
R4754:Olfr1245 UTSW 2 89575047 missense probably benign
R4923:Olfr1245 UTSW 2 89575679 missense probably damaging 0.98
R5303:Olfr1245 UTSW 2 89575001 missense possibly damaging 0.88
R5574:Olfr1245 UTSW 2 89574977 missense possibly damaging 0.94
R6083:Olfr1245 UTSW 2 89575672 missense probably benign 0.42
R6188:Olfr1245 UTSW 2 89575194 nonsense probably null
R6724:Olfr1245 UTSW 2 89574965 missense probably benign 0.26
R6964:Olfr1245 UTSW 2 89574989 missense probably benign
R7066:Olfr1245 UTSW 2 89575703 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGTCTGTGCATGCAAGTACC -3'
(R):5'- GTGACAGTCATTACCAGCCC -3'

Sequencing Primer
(F):5'- GTCTGTGCATGCAAGTACCAATAATG -3'
(R):5'- AGTCATTACCAGCCCCTCCTTG -3'
Posted On2014-08-25