Incidental Mutation 'R2004:Apoc4'
List |< first << previous [record 83 of 1308] next >> last >|
ID223369
Institutional Source Beutler Lab
Gene Symbol Apoc4
Ensembl Gene ENSMUSG00000074336
Gene Nameapolipoprotein C-IV
SynonymsAcl
MMRRC Submission 040013-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R2004 (G1)
Quality Score194
Status Not validated
Chromosome7
Chromosomal Location19678083-19681479 bp(-) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) A to G at 19681379 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 1 (M1T)
Ref Sequence ENSEMBL: ENSMUSP00000003071 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003071] [ENSMUST00000003074] [ENSMUST00000127648] [ENSMUST00000142352] [ENSMUST00000150569]
Predicted Effect probably null
Transcript: ENSMUST00000003071
AA Change: M1T

PolyPhen 2 Score 0.533 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000003071
Gene: ENSMUSG00000074336
AA Change: M1T

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:APOC4 28 121 9.6e-56 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000003074
SMART Domains Protein: ENSMUSP00000003074
Gene: ENSMUSG00000002992

DomainStartEndE-ValueType
Pfam:Apo-CII 20 97 4.4e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127648
SMART Domains Protein: ENSMUSP00000118305
Gene: ENSMUSG00000109350

DomainStartEndE-ValueType
Pfam:Apo-CII 20 68 2.7e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000142352
SMART Domains Protein: ENSMUSP00000115173
Gene: ENSMUSG00000002992

DomainStartEndE-ValueType
Pfam:Apo-CII 21 97 1.8e-42 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000150569
SMART Domains Protein: ENSMUSP00000114512
Gene: ENSMUSG00000109350

DomainStartEndE-ValueType
Pfam:Apo-CII 20 97 4.4e-46 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209130
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a lipid-binding protein belonging to the apolipoprotein gene family. The protein is thought to play a role in lipid metabolism. Polymorphisms in this gene may influence circulating lipid levels and may be associated with coronary artery disease risk. This gene is present in a cluster with other related apolipoprotein genes on chromosome 19. Naturally occurring read-through transcription exists between this gene and the neighboring downstream apolipoprotein C-II (APOC2) gene. [provided by RefSeq, Mar 2011]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik C T 3: 36,895,378 T2I possibly damaging Het
Aass A T 6: 23,092,562 Y146* probably null Het
Adcy2 A G 13: 68,796,603 L220P probably damaging Het
Agl T C 3: 116,781,265 Y660C probably damaging Het
Ak1 A G 2: 32,629,610 T17A probably benign Het
Amph G A 13: 19,142,028 V643M probably damaging Het
Ankrd11 A T 8: 122,902,422 probably null Het
Ap5b1 T C 19: 5,570,474 S641P possibly damaging Het
Arhgap5 T C 12: 52,518,034 V596A probably benign Het
Ascc3 A G 10: 50,617,742 E91G probably damaging Het
Bach2 T A 4: 32,580,055 V637E probably benign Het
Bicd2 T G 13: 49,379,405 L489R possibly damaging Het
Boc A T 16: 44,501,644 probably null Het
Cbln2 T A 18: 86,716,666 V188D probably damaging Het
Ccl11 A C 11: 82,062,297 T94P probably damaging Het
Cd109 A T 9: 78,703,762 H1220L probably benign Het
Cd226 A G 18: 89,247,311 I125V probably benign Het
Cep135 T A 5: 76,632,329 probably null Het
Cgnl1 T G 9: 71,630,539 E1233A probably damaging Het
Ckap5 T A 2: 91,607,546 D1597E possibly damaging Het
Clptm1 A G 7: 19,646,837 I63T possibly damaging Het
Cpsf7 C T 19: 10,540,709 P428S probably damaging Het
Cuedc1 C T 11: 88,177,390 P155S probably damaging Het
Dgkb T C 12: 38,084,229 Y45H probably damaging Het
Dglucy T C 12: 100,856,922 F459L probably damaging Het
Dmp1 T A 5: 104,211,924 D155E possibly damaging Het
Dnah1 T A 14: 31,301,856 I960F possibly damaging Het
Drosha G T 15: 12,915,381 M795I probably damaging Het
Dsg1b A G 18: 20,396,475 T326A probably damaging Het
Dusp16 T G 6: 134,718,839 N343T probably benign Het
Faim2 T C 15: 99,500,246 S274G possibly damaging Het
Fam155a A G 8: 9,770,607 S138P probably benign Het
Fam160b1 G T 19: 57,381,892 V523L probably benign Het
Fndc1 T C 17: 7,804,929 R65G probably damaging Het
Fnip2 A T 3: 79,512,325 probably benign Het
Gm597 A G 1: 28,777,179 W591R probably damaging Het
Grm3 T C 5: 9,589,793 Y84C possibly damaging Het
Herc2 T C 7: 56,137,859 F1755L probably damaging Het
Hivep1 C T 13: 42,160,149 T1955I possibly damaging Het
Ift20 T C 11: 78,540,971 I97T probably damaging Het
Il1f5 T C 2: 24,281,364 C155R probably damaging Het
Lca5l T A 16: 96,162,649 K358N probably damaging Het
Lca5l T C 16: 96,176,018 N196S possibly damaging Het
Maf1 G A 15: 76,353,363 D175N probably damaging Het
Mical3 T C 6: 120,951,322 K996E probably damaging Het
Midn A G 10: 80,155,149 N331S probably benign Het
Mki67 T A 7: 135,698,509 K1599* probably null Het
Mlx A G 11: 101,088,979 Q162R possibly damaging Het
Ngp T C 9: 110,420,861 C76R probably damaging Het
Nin C T 12: 70,025,477 G1210D probably benign Het
Nlgn1 A G 3: 25,433,870 I738T probably benign Het
Nop53 A C 7: 15,938,228 F465C probably damaging Het
Npas3 A G 12: 54,067,897 D503G possibly damaging Het
Npbwr1 T A 1: 5,916,351 S315C probably damaging Het
Nupl2 G T 5: 24,181,991 G260* probably null Het
Ogdh G C 11: 6,334,626 R200P possibly damaging Het
Olfr1026 T G 2: 85,923,595 probably null Het
Olfr142 T A 2: 90,252,692 I99L probably benign Het
Olfr522 C T 7: 140,162,816 V45I probably damaging Het
Olfr659 A G 7: 104,671,601 T300A possibly damaging Het
Olfr828 G A 9: 18,815,505 S263L probably benign Het
Olfr853 A T 9: 19,537,392 C179* probably null Het
Ovgp1 T A 3: 105,986,993 probably benign Het
Papln T A 12: 83,773,218 C150S probably damaging Het
Pde1c A T 6: 56,159,011 L316Q probably damaging Het
Pdlim2 C T 14: 70,164,779 R296H probably damaging Het
Piezo2 G T 18: 63,144,926 D302E probably damaging Het
Pirb A T 7: 3,717,638 L287Q probably benign Het
Plin1 A G 7: 79,725,630 probably benign Het
Plxnc1 A G 10: 94,852,622 I698T probably damaging Het
Ppp1r12c G T 7: 4,482,975 C572* probably null Het
Ptgis T C 2: 167,214,849 M273V possibly damaging Het
Samd14 C A 11: 95,023,284 T283K probably damaging Het
Scnn1g A T 7: 121,738,188 K91* probably null Het
Slc24a4 A G 12: 102,213,907 Q95R probably damaging Het
Slfn9 T G 11: 82,988,201 D34A probably benign Het
Smarca4 A T 9: 21,677,480 I1193F probably damaging Het
Sphkap T C 1: 83,277,911 M706V probably benign Het
Stard9 C A 2: 120,673,636 S221R probably damaging Het
Stxbp1 T C 2: 32,798,189 D488G probably damaging Het
Sugp2 C T 8: 70,242,656 probably null Het
Tekt5 T C 16: 10,395,206 I72V probably benign Het
Themis T A 10: 28,782,724 N582K probably benign Het
Tmed11 C A 5: 108,786,134 M65I possibly damaging Het
Top3a G T 11: 60,742,489 P927Q probably damaging Het
Trpa1 A T 1: 14,905,983 N165K possibly damaging Het
Tsfm A G 10: 127,030,794 S2P probably damaging Het
Wdr47 C A 3: 108,627,442 S559* probably null Het
Wnt2b T C 3: 104,953,015 Y192C probably damaging Het
Zfp280b A G 10: 76,038,536 D83G probably benign Het
Zfp345 T C 2: 150,472,118 T500A possibly damaging Het
Zfp78 T A 7: 6,379,075 C343S probably damaging Het
Other mutations in Apoc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00234:Apoc4 APN 7 19678740 missense probably benign 0.26
IGL01696:Apoc4 APN 7 19678184 missense probably damaging 1.00
R2150:Apoc4 UTSW 7 19678635 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGTCACGTTCCTCTTACATGG -3'
(R):5'- GTGTCTTGTACAAGGCCAGG -3'

Sequencing Primer
(F):5'- TGGCTACTGACCCACTGATGAAG -3'
(R):5'- AGGGCGGCACACTGTTTAG -3'
Posted On2014-08-25