Incidental Mutation 'R2018:Arhgef10l'
ID223386
Institutional Source Beutler Lab
Gene Symbol Arhgef10l
Ensembl Gene ENSMUSG00000040964
Gene NameRho guanine nucleotide exchange factor (GEF) 10-like
Synonyms2810441C07Rik
MMRRC Submission 040027-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.348) question?
Stock #R2018 (G1)
Quality Score199
Status Not validated
Chromosome4
Chromosomal Location140514485-140666012 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 140544384 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 560 (S560P)
Ref Sequence ENSEMBL: ENSMUSP00000101423 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039204] [ENSMUST00000069623] [ENSMUST00000097820] [ENSMUST00000105797] [ENSMUST00000105798] [ENSMUST00000105799] [ENSMUST00000140403]
Predicted Effect probably damaging
Transcript: ENSMUST00000039204
AA Change: S847P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000040531
Gene: ENSMUSG00000040964
AA Change: S847P

DomainStartEndE-ValueType
low complexity region 10 25 N/A INTRINSIC
low complexity region 28 49 N/A INTRINSIC
low complexity region 78 89 N/A INTRINSIC
low complexity region 105 116 N/A INTRINSIC
low complexity region 170 184 N/A INTRINSIC
RhoGEF 318 500 1.95e-52 SMART
Blast:PH 535 748 3e-82 BLAST
low complexity region 821 833 N/A INTRINSIC
low complexity region 864 876 N/A INTRINSIC
Blast:WD40 1217 1270 8e-18 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000069623
AA Change: S813P

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000066249
Gene: ENSMUSG00000040964
AA Change: S813P

DomainStartEndE-ValueType
low complexity region 10 25 N/A INTRINSIC
low complexity region 28 49 N/A INTRINSIC
low complexity region 78 89 N/A INTRINSIC
low complexity region 105 116 N/A INTRINSIC
low complexity region 170 184 N/A INTRINSIC
RhoGEF 279 461 1.95e-52 SMART
Blast:PH 496 714 5e-80 BLAST
low complexity region 787 799 N/A INTRINSIC
low complexity region 830 842 N/A INTRINSIC
Blast:WD40 1183 1236 7e-18 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000097820
AA Change: S808P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000095431
Gene: ENSMUSG00000040964
AA Change: S808P

DomainStartEndE-ValueType
low complexity region 10 25 N/A INTRINSIC
low complexity region 28 49 N/A INTRINSIC
low complexity region 78 89 N/A INTRINSIC
low complexity region 105 116 N/A INTRINSIC
low complexity region 170 184 N/A INTRINSIC
RhoGEF 279 461 1.95e-52 SMART
Blast:PH 496 709 3e-82 BLAST
low complexity region 782 794 N/A INTRINSIC
low complexity region 825 837 N/A INTRINSIC
Blast:WD40 1178 1231 6e-18 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000105797
AA Change: S560P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000101423
Gene: ENSMUSG00000040964
AA Change: S560P

DomainStartEndE-ValueType
low complexity region 50 62 N/A INTRINSIC
Pfam:RhoGEF 101 183 7.1e-15 PFAM
low complexity region 195 213 N/A INTRINSIC
Blast:PH 248 461 7e-83 BLAST
low complexity region 534 546 N/A INTRINSIC
low complexity region 577 589 N/A INTRINSIC
Blast:WD40 618 656 6e-15 BLAST
Blast:WD40 930 983 1e-17 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000105798
AA Change: S612P

PolyPhen 2 Score 0.857 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000101424
Gene: ENSMUSG00000040964
AA Change: S612P

DomainStartEndE-ValueType
RhoGEF 78 260 1.95e-52 SMART
Blast:PH 295 513 8e-81 BLAST
low complexity region 586 598 N/A INTRINSIC
low complexity region 629 641 N/A INTRINSIC
Blast:WD40 982 1035 6e-18 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000105799
AA Change: S852P

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000101425
Gene: ENSMUSG00000040964
AA Change: S852P

DomainStartEndE-ValueType
low complexity region 10 25 N/A INTRINSIC
low complexity region 28 49 N/A INTRINSIC
low complexity region 78 89 N/A INTRINSIC
low complexity region 105 116 N/A INTRINSIC
low complexity region 170 184 N/A INTRINSIC
RhoGEF 318 500 1.95e-52 SMART
Blast:PH 535 753 5e-80 BLAST
low complexity region 826 838 N/A INTRINSIC
low complexity region 869 881 N/A INTRINSIC
Blast:WD40 1222 1275 8e-18 BLAST
Predicted Effect unknown
Transcript: ENSMUST00000138493
AA Change: S392P
SMART Domains Protein: ENSMUSP00000119471
Gene: ENSMUSG00000040964
AA Change: S392P

DomainStartEndE-ValueType
Pfam:RhoGEF 1 46 3.1e-11 PFAM
Blast:PH 81 294 3e-86 BLAST
low complexity region 367 379 N/A INTRINSIC
Blast:WD40 387 446 8e-6 BLAST
Blast:WD40 451 489 3e-15 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000140403
SMART Domains Protein: ENSMUSP00000117038
Gene: ENSMUSG00000040964

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
Blast:PH 16 127 3e-57 BLAST
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the RhoGEF subfamily of RhoGTPases. Members of this subfamily are activated by specific guanine nucleotide exchange factors (GEFs) and are involved in signal transduction. The encoded protein shows cytosolic distribution. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2016]
Allele List at MGI
Other mutations in this stock
Total: 111 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610028H24Rik C A 10: 76,458,065 F252L possibly damaging Het
4921501E09Rik T C 17: 33,066,967 N287S probably benign Het
4930447A16Rik T G 15: 37,440,498 probably benign Het
Abca14 A T 7: 120,216,185 M219L probably benign Het
Abi3bp A G 16: 56,677,796 T918A probably damaging Het
Acss3 C T 10: 106,936,207 S669N probably benign Het
Adamts16 G A 13: 70,779,518 probably benign Het
Adamtsl4 A G 3: 95,681,102 Y559H probably damaging Het
Adgrg5 T A 8: 94,934,480 M106K probably damaging Het
Akt1 T C 12: 112,659,625 N71S probably damaging Het
Amer2 A C 14: 60,378,445 K30Q probably damaging Het
Anapc5 T C 5: 122,800,524 K383E probably damaging Het
Ano1 A G 7: 144,654,250 L258P probably damaging Het
Arhgef40 T A 14: 52,003,705 L1395Q probably damaging Het
Arid1a A T 4: 133,681,834 D1787E unknown Het
C77080 A G 4: 129,222,355 S884P probably damaging Het
Ces2h T C 8: 105,018,398 L388P probably damaging Het
Cfap54 T A 10: 93,016,604 N880I probably benign Het
Cryz T C 3: 154,621,683 V116A probably damaging Het
Csrp1 G A 1: 135,750,628 A159T probably damaging Het
Cttnbp2 A G 6: 18,434,518 F447S probably damaging Het
Cyp4a12a A T 4: 115,327,505 I328F probably damaging Het
Cyth4 T G 15: 78,608,171 H133Q probably damaging Het
Ddah2 A G 17: 35,060,426 I88V possibly damaging Het
Dmbt1 T G 7: 131,110,989 I1563S possibly damaging Het
Dnajc22 T C 15: 99,101,233 S100P probably benign Het
Fam172a A G 13: 77,999,637 T321A possibly damaging Het
Fancl T A 11: 26,422,459 D123E probably damaging Het
Fbxo30 A G 10: 11,291,028 Q498R probably damaging Het
Fgd4 T C 16: 16,435,960 H581R probably benign Het
Gm2663 T C 6: 40,997,966 Q57R probably benign Het
Gm5065 A G 7: 5,359,574 D68G probably benign Het
Gm7247 A T 14: 51,365,347 M47L possibly damaging Het
Gsdmc2 T A 15: 63,828,126 probably null Het
Hc A C 2: 35,013,528 F1038C probably damaging Het
Heatr1 C A 13: 12,414,478 Q890K possibly damaging Het
Hipk4 C A 7: 27,529,004 T293K probably damaging Het
Hp1bp3 C A 4: 138,221,632 A2E probably damaging Het
Il6 T C 5: 30,014,947 probably null Het
Itga6 A G 2: 71,818,484 D104G probably benign Het
Krt24 A G 11: 99,282,451 S293P probably damaging Het
Krt4 C T 15: 101,920,651 R309Q probably damaging Het
Krt40 A T 11: 99,540,087 W199R probably damaging Het
Lamc1 T C 1: 153,242,632 E931G probably benign Het
Lamp3 A T 16: 19,701,211 M74K probably benign Het
Magel2 G A 7: 62,379,096 V583I unknown Het
March7 T A 2: 60,229,040 Y37* probably null Het
Mrpl36 A G 13: 73,331,568 K66E probably damaging Het
Mrps35 G T 6: 147,061,484 E229* probably null Het
Mtmr6 T C 14: 60,298,992 M557T probably benign Het
Myocd A T 11: 65,187,028 I647N probably damaging Het
Myom2 A C 8: 15,131,151 L1350F probably damaging Het
Nosip T A 7: 45,076,609 S197T probably benign Het
Npat A G 9: 53,562,491 K528E probably benign Het
Nyap2 A G 1: 81,191,872 T115A probably benign Het
Olfr1032 A T 2: 86,008,223 Y149F probably damaging Het
Olfr1214 G T 2: 88,988,145 P19Q probably benign Het
Olfr122 A G 17: 37,772,576 R317G probably benign Het
Olfr1245 A G 2: 89,575,393 V111A probably damaging Het
Olfr65 T A 7: 103,907,042 V201D possibly damaging Het
Olfr972 A G 9: 39,874,058 Q261R probably benign Het
Orc1 T C 4: 108,590,700 V48A possibly damaging Het
Pde6d T C 1: 86,546,716 E69G probably damaging Het
Pdgfrb A T 18: 61,083,334 D1088V possibly damaging Het
Peg12 A G 7: 62,463,638 V237A probably benign Het
Piezo1 A G 8: 122,482,712 F2371L probably benign Het
Podn T A 4: 108,023,373 S27C probably damaging Het
Pom121l2 A G 13: 21,982,734 M392V possibly damaging Het
Ppm1b A G 17: 84,994,202 K170R probably damaging Het
Rab18 A T 18: 6,770,113 probably null Het
Raet1d G A 10: 22,371,012 A80T probably damaging Het
Rfx7 T A 9: 72,617,685 V719E probably benign Het
Rnf219 T A 14: 104,522,542 K24M probably damaging Het
Ror1 C T 4: 100,407,841 Q171* probably null Het
Rufy4 G A 1: 74,140,947 V454M possibly damaging Het
Ryr2 C T 13: 11,851,188 G292D possibly damaging Het
Ryr3 G T 2: 112,781,065 N2257K probably benign Het
Saal1 A G 7: 46,699,489 F306S possibly damaging Het
Sap18 A G 14: 57,798,564 N69S probably damaging Het
Sar1b A T 11: 51,779,687 probably null Het
Serpina3n G T 12: 104,409,214 V182L probably damaging Het
Setd3 A T 12: 108,118,254 H279Q probably damaging Het
Slc18a2 C A 19: 59,276,505 A307E possibly damaging Het
Slc4a10 A T 2: 62,234,381 D193V probably damaging Het
Spire2 T C 8: 123,332,918 C52R probably damaging Het
Syne2 A T 12: 76,074,579 I5940F probably damaging Het
Sytl1 C T 4: 133,256,160 S355N probably damaging Het
Tarbp1 C T 8: 126,428,114 V1424I probably damaging Het
Tatdn3 A T 1: 191,049,280 probably null Het
Tbpl1 T A 10: 22,707,677 E131D probably damaging Het
Telo2 A T 17: 25,105,408 M501K probably damaging Het
Terb1 A G 8: 104,452,699 V619A probably benign Het
Tmem132e A G 11: 82,445,163 T1024A probably benign Het
Tmem30a T C 9: 79,774,218 D223G probably damaging Het
Tmprss11d A G 5: 86,339,554 V19A probably damaging Het
Tnks A T 8: 34,851,106 S872T probably damaging Het
Tnxb A G 17: 34,671,750 S356G probably benign Het
Tob2 T C 15: 81,851,199 K190E probably damaging Het
Togaram1 T C 12: 65,002,659 V1240A possibly damaging Het
Trim13 T A 14: 61,604,886 C117* probably null Het
Trpv4 G A 5: 114,634,605 R308C probably damaging Het
Ttn C G 2: 76,755,332 D21987H probably damaging Het
Ttn C A 2: 76,826,074 probably null Het
Upp1 A T 11: 9,133,240 M111L possibly damaging Het
Vmn1r206 A T 13: 22,620,188 V283E probably damaging Het
Vmn2r79 G T 7: 87,002,426 L344F probably benign Het
Vmn2r93 T G 17: 18,326,062 I732S probably damaging Het
Vmn2r96 G T 17: 18,584,001 M504I probably benign Het
Vps39 T C 2: 120,343,227 Y147C probably damaging Het
Zbtb20 T A 16: 43,577,652 C35S possibly damaging Het
Zfp871 A T 17: 32,774,777 C475S probably damaging Het
Other mutations in Arhgef10l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01420:Arhgef10l APN 4 140570338 missense probably damaging 0.98
IGL01732:Arhgef10l APN 4 140580415 missense probably damaging 0.99
IGL01988:Arhgef10l APN 4 140578361 splice site probably benign
IGL02031:Arhgef10l APN 4 140575345 missense probably damaging 1.00
IGL02253:Arhgef10l APN 4 140544284 nonsense probably null
IGL02445:Arhgef10l APN 4 140547007 missense probably benign 0.19
IGL02619:Arhgef10l APN 4 140594193 missense probably benign 0.07
IGL02798:Arhgef10l APN 4 140565130 critical splice donor site probably null
IGL03064:Arhgef10l APN 4 140579279 missense probably damaging 1.00
IGL03178:Arhgef10l APN 4 140544428 missense possibly damaging 0.92
IGL03236:Arhgef10l APN 4 140611360 missense probably damaging 1.00
IGL03352:Arhgef10l APN 4 140583931 start codon destroyed probably null 0.99
PIT4494001:Arhgef10l UTSW 4 140565211 missense probably damaging 0.98
R0057:Arhgef10l UTSW 4 140611218 splice site probably benign
R0062:Arhgef10l UTSW 4 140552532 missense probably damaging 1.00
R0109:Arhgef10l UTSW 4 140578294 missense probably benign 0.02
R0109:Arhgef10l UTSW 4 140578294 missense probably benign 0.02
R0114:Arhgef10l UTSW 4 140583883 missense probably benign 0.17
R0334:Arhgef10l UTSW 4 140583926 nonsense probably null
R0742:Arhgef10l UTSW 4 140536845 missense probably damaging 1.00
R1017:Arhgef10l UTSW 4 140515306 missense probably damaging 0.99
R1166:Arhgef10l UTSW 4 140575270 unclassified probably benign
R1397:Arhgef10l UTSW 4 140544443 missense probably damaging 0.98
R1521:Arhgef10l UTSW 4 140515438 missense possibly damaging 0.95
R1707:Arhgef10l UTSW 4 140564289 missense probably damaging 1.00
R1793:Arhgef10l UTSW 4 140515373 missense probably damaging 0.97
R2093:Arhgef10l UTSW 4 140570290 missense possibly damaging 0.57
R2098:Arhgef10l UTSW 4 140579432 missense probably damaging 1.00
R2310:Arhgef10l UTSW 4 140593118 missense probably damaging 1.00
R2879:Arhgef10l UTSW 4 140515287 missense probably benign 0.09
R2883:Arhgef10l UTSW 4 140516802 missense probably benign 0.02
R3732:Arhgef10l UTSW 4 140581619 small deletion probably benign
R3732:Arhgef10l UTSW 4 140581619 small deletion probably benign
R3861:Arhgef10l UTSW 4 140515487 missense possibly damaging 0.94
R4049:Arhgef10l UTSW 4 140515451 missense probably benign 0.05
R4322:Arhgef10l UTSW 4 140542726 missense probably benign 0.07
R4707:Arhgef10l UTSW 4 140536883 missense possibly damaging 0.63
R5395:Arhgef10l UTSW 4 140570290 missense probably benign 0.16
R5720:Arhgef10l UTSW 4 140581619 small deletion probably benign
R6066:Arhgef10l UTSW 4 140577080 missense probably damaging 1.00
R6190:Arhgef10l UTSW 4 140542762 missense possibly damaging 0.90
R6464:Arhgef10l UTSW 4 140586815 missense probably benign 0.05
R6476:Arhgef10l UTSW 4 140611382 missense probably damaging 1.00
R6478:Arhgef10l UTSW 4 140542757 missense possibly damaging 0.91
R6483:Arhgef10l UTSW 4 140616915 missense probably damaging 0.99
R6631:Arhgef10l UTSW 4 140517747 intron probably benign
R6721:Arhgef10l UTSW 4 140570344 missense probably damaging 1.00
R6890:Arhgef10l UTSW 4 140544419 missense probably damaging 1.00
R7098:Arhgef10l UTSW 4 140580911 missense probably benign 0.01
R7100:Arhgef10l UTSW 4 140516815 missense possibly damaging 0.60
R7117:Arhgef10l UTSW 4 140564186 critical splice donor site probably null
Z1088:Arhgef10l UTSW 4 140581735 missense possibly damaging 0.53
Predicted Primers PCR Primer
(F):5'- GCTTAGGTTAGCAGCCCACA -3'
(R):5'- CTGTGTATCTCCGTGTCTCTGTG -3'

Sequencing Primer
(F):5'- GGACTTCCTGCAGCCATCTAG -3'
(R):5'- ATCTCCGTGTCTCTGTGTGTGTG -3'
Posted On2014-08-25