Incidental Mutation 'R2004:Npas3'
ID223450
Institutional Source Beutler Lab
Gene Symbol Npas3
Ensembl Gene ENSMUSG00000021010
Gene Nameneuronal PAS domain protein 3
Synonyms4930423H22Rik, bHLHe12
MMRRC Submission 040013-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.837) question?
Stock #R2004 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location53248677-54072175 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 54067897 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 503 (D503G)
Ref Sequence ENSEMBL: ENSMUSP00000152411 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000101432] [ENSMUST00000223057] [ENSMUST00000223358]
Predicted Effect probably benign
Transcript: ENSMUST00000101432
AA Change: D534G

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000098975
Gene: ENSMUSG00000021010
AA Change: D534G

DomainStartEndE-ValueType
HLH 64 119 1.34e-6 SMART
PAS 154 220 8.69e-11 SMART
low complexity region 234 256 N/A INTRINSIC
PAS 326 392 7.4e-5 SMART
PAC 398 441 2.46e-1 SMART
low complexity region 461 477 N/A INTRINSIC
low complexity region 524 544 N/A INTRINSIC
low complexity region 598 627 N/A INTRINSIC
low complexity region 696 709 N/A INTRINSIC
low complexity region 739 754 N/A INTRINSIC
low complexity region 759 773 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185390
Predicted Effect probably benign
Transcript: ENSMUST00000223057
AA Change: D516G

PolyPhen 2 Score 0.065 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect possibly damaging
Transcript: ENSMUST00000223358
AA Change: D503G

PolyPhen 2 Score 0.625 (Sensitivity: 0.87; Specificity: 0.91)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the basic helix-loop-helix and PAS domain-containing family of transcription factors. The encoded protein is localized to the nucleus and may regulate genes involved in neurogenesis. Chromosomal abnormalities that affect the coding potential of this gene are associated with schizophrenia and mental retardation. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for some knock-out alleles exhibit abnormal behavior and nervous system morphology. Mice homozygous for another knock-out allele exhibit defective lung branching morphogenesis and die shortly after birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik C T 3: 36,895,378 T2I possibly damaging Het
Aass A T 6: 23,092,562 Y146* probably null Het
Adcy2 A G 13: 68,796,603 L220P probably damaging Het
Agl T C 3: 116,781,265 Y660C probably damaging Het
Ak1 A G 2: 32,629,610 T17A probably benign Het
Amph G A 13: 19,142,028 V643M probably damaging Het
Ankrd11 A T 8: 122,902,422 probably null Het
Ap5b1 T C 19: 5,570,474 S641P possibly damaging Het
Apoc4 A G 7: 19,681,379 M1T probably null Het
Arhgap5 T C 12: 52,518,034 V596A probably benign Het
Ascc3 A G 10: 50,617,742 E91G probably damaging Het
Bach2 T A 4: 32,580,055 V637E probably benign Het
Bicd2 T G 13: 49,379,405 L489R possibly damaging Het
Boc A T 16: 44,501,644 probably null Het
Cbln2 T A 18: 86,716,666 V188D probably damaging Het
Ccl11 A C 11: 82,062,297 T94P probably damaging Het
Cd109 A T 9: 78,703,762 H1220L probably benign Het
Cd226 A G 18: 89,247,311 I125V probably benign Het
Cep135 T A 5: 76,632,329 probably null Het
Cgnl1 T G 9: 71,630,539 E1233A probably damaging Het
Ckap5 T A 2: 91,607,546 D1597E possibly damaging Het
Clptm1 A G 7: 19,646,837 I63T possibly damaging Het
Cpsf7 C T 19: 10,540,709 P428S probably damaging Het
Cuedc1 C T 11: 88,177,390 P155S probably damaging Het
Dgkb T C 12: 38,084,229 Y45H probably damaging Het
Dglucy T C 12: 100,856,922 F459L probably damaging Het
Dmp1 T A 5: 104,211,924 D155E possibly damaging Het
Dnah1 T A 14: 31,301,856 I960F possibly damaging Het
Drosha G T 15: 12,915,381 M795I probably damaging Het
Dsg1b A G 18: 20,396,475 T326A probably damaging Het
Dusp16 T G 6: 134,718,839 N343T probably benign Het
Faim2 T C 15: 99,500,246 S274G possibly damaging Het
Fam155a A G 8: 9,770,607 S138P probably benign Het
Fam160b1 G T 19: 57,381,892 V523L probably benign Het
Fndc1 T C 17: 7,804,929 R65G probably damaging Het
Fnip2 A T 3: 79,512,325 probably benign Het
Gm597 A G 1: 28,777,179 W591R probably damaging Het
Grm3 T C 5: 9,589,793 Y84C possibly damaging Het
Herc2 T C 7: 56,137,859 F1755L probably damaging Het
Hivep1 C T 13: 42,160,149 T1955I possibly damaging Het
Ift20 T C 11: 78,540,971 I97T probably damaging Het
Il1f5 T C 2: 24,281,364 C155R probably damaging Het
Lca5l T A 16: 96,162,649 K358N probably damaging Het
Lca5l T C 16: 96,176,018 N196S possibly damaging Het
Maf1 G A 15: 76,353,363 D175N probably damaging Het
Mical3 T C 6: 120,951,322 K996E probably damaging Het
Midn A G 10: 80,155,149 N331S probably benign Het
Mki67 T A 7: 135,698,509 K1599* probably null Het
Mlx A G 11: 101,088,979 Q162R possibly damaging Het
Ngp T C 9: 110,420,861 C76R probably damaging Het
Nin C T 12: 70,025,477 G1210D probably benign Het
Nlgn1 A G 3: 25,433,870 I738T probably benign Het
Nop53 A C 7: 15,938,228 F465C probably damaging Het
Npbwr1 T A 1: 5,916,351 S315C probably damaging Het
Nupl2 G T 5: 24,181,991 G260* probably null Het
Ogdh G C 11: 6,334,626 R200P possibly damaging Het
Olfr1026 T G 2: 85,923,595 probably null Het
Olfr142 T A 2: 90,252,692 I99L probably benign Het
Olfr522 C T 7: 140,162,816 V45I probably damaging Het
Olfr659 A G 7: 104,671,601 T300A possibly damaging Het
Olfr828 G A 9: 18,815,505 S263L probably benign Het
Olfr853 A T 9: 19,537,392 C179* probably null Het
Ovgp1 T A 3: 105,986,993 probably benign Het
Papln T A 12: 83,773,218 C150S probably damaging Het
Pde1c A T 6: 56,159,011 L316Q probably damaging Het
Pdlim2 C T 14: 70,164,779 R296H probably damaging Het
Piezo2 G T 18: 63,144,926 D302E probably damaging Het
Pirb A T 7: 3,717,638 L287Q probably benign Het
Plin1 A G 7: 79,725,630 probably benign Het
Plxnc1 A G 10: 94,852,622 I698T probably damaging Het
Ppp1r12c G T 7: 4,482,975 C572* probably null Het
Ptgis T C 2: 167,214,849 M273V possibly damaging Het
Samd14 C A 11: 95,023,284 T283K probably damaging Het
Scnn1g A T 7: 121,738,188 K91* probably null Het
Slc24a4 A G 12: 102,213,907 Q95R probably damaging Het
Slfn9 T G 11: 82,988,201 D34A probably benign Het
Smarca4 A T 9: 21,677,480 I1193F probably damaging Het
Sphkap T C 1: 83,277,911 M706V probably benign Het
Stard9 C A 2: 120,673,636 S221R probably damaging Het
Stxbp1 T C 2: 32,798,189 D488G probably damaging Het
Sugp2 C T 8: 70,242,656 probably null Het
Tekt5 T C 16: 10,395,206 I72V probably benign Het
Themis T A 10: 28,782,724 N582K probably benign Het
Tmed11 C A 5: 108,786,134 M65I possibly damaging Het
Top3a G T 11: 60,742,489 P927Q probably damaging Het
Trpa1 A T 1: 14,905,983 N165K possibly damaging Het
Tsfm A G 10: 127,030,794 S2P probably damaging Het
Wdr47 C A 3: 108,627,442 S559* probably null Het
Wnt2b T C 3: 104,953,015 Y192C probably damaging Het
Zfp280b A G 10: 76,038,536 D83G probably benign Het
Zfp345 T C 2: 150,472,118 T500A possibly damaging Het
Zfp78 T A 7: 6,379,075 C343S probably damaging Het
Other mutations in Npas3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01021:Npas3 APN 12 54003560 missense probably damaging 1.00
IGL01330:Npas3 APN 12 54048819 missense probably damaging 1.00
IGL01376:Npas3 APN 12 54044586 missense probably benign 0.01
IGL01634:Npas3 APN 12 53947163 missense probably damaging 1.00
IGL02456:Npas3 APN 12 54048767 missense probably damaging 0.99
IGL02663:Npas3 APN 12 54068908 missense probably damaging 1.00
IGL02731:Npas3 APN 12 54067795 missense probably benign 0.01
IGL02955:Npas3 APN 12 53501265 missense probably damaging 0.96
IGL03001:Npas3 APN 12 53501192 missense probably damaging 1.00
IGL03047:Npas3 APN 12 53831687 splice site probably benign
ANU05:Npas3 UTSW 12 54068074 missense possibly damaging 0.49
IGL02837:Npas3 UTSW 12 53947197 missense possibly damaging 0.79
R0042:Npas3 UTSW 12 54048841 missense probably damaging 1.00
R0042:Npas3 UTSW 12 54048841 missense probably damaging 1.00
R0396:Npas3 UTSW 12 53831745 missense probably damaging 1.00
R1687:Npas3 UTSW 12 54048875 splice site probably null
R1863:Npas3 UTSW 12 54068826 missense probably damaging 1.00
R2047:Npas3 UTSW 12 54068829 missense probably damaging 0.99
R2049:Npas3 UTSW 12 54062088 missense probably damaging 1.00
R2278:Npas3 UTSW 12 53640502 missense possibly damaging 0.92
R2323:Npas3 UTSW 12 54068346 missense probably damaging 1.00
R2871:Npas3 UTSW 12 54068013 nonsense probably null
R2871:Npas3 UTSW 12 54068013 nonsense probably null
R3116:Npas3 UTSW 12 54067725 splice site probably null
R3431:Npas3 UTSW 12 54069049 missense probably damaging 0.99
R3731:Npas3 UTSW 12 53354392 missense probably benign 0.11
R3767:Npas3 UTSW 12 54069074 makesense probably null
R4332:Npas3 UTSW 12 54062069 missense probably damaging 0.99
R4593:Npas3 UTSW 12 54068497 missense probably benign 0.08
R4601:Npas3 UTSW 12 54044578 missense probably damaging 0.99
R4654:Npas3 UTSW 12 54062132 critical splice donor site probably null
R4946:Npas3 UTSW 12 54065835 missense probably damaging 1.00
R5140:Npas3 UTSW 12 53501114 nonsense probably null
R5302:Npas3 UTSW 12 54068836 missense probably damaging 1.00
R5524:Npas3 UTSW 12 54068938 missense possibly damaging 0.64
R5735:Npas3 UTSW 12 54003479 missense probably benign 0.00
R6252:Npas3 UTSW 12 54068890 missense probably damaging 1.00
R6438:Npas3 UTSW 12 54068698 missense probably damaging 0.99
R6987:Npas3 UTSW 12 54068253 missense possibly damaging 0.94
R6994:Npas3 UTSW 12 54068793 missense probably damaging 0.96
R7304:Npas3 UTSW 12 54069041 missense probably damaging 1.00
X0003:Npas3 UTSW 12 54044728 splice site probably null
X0064:Npas3 UTSW 12 53354384 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- ACTGTGCTCCTGCTATGCTG -3'
(R):5'- TGATCTTGAGCACAGAGGCG -3'

Sequencing Primer
(F):5'- ATGCTGGGTCCTAAATTCTTCAG -3'
(R):5'- CTTGCTGGATGCCTGAGC -3'
Posted On2014-08-25