Incidental Mutation 'R0141:Osbp'
ID22348
Institutional Source Beutler Lab
Gene Symbol Osbp
Ensembl Gene ENSMUSG00000024687
Gene Nameoxysterol binding protein
Synonyms
MMRRC Submission 038426-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.965) question?
Stock #R0141 (G1)
Quality Score225
Status Validated (trace)
Chromosome19
Chromosomal Location11965844-11994105 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 11973859 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 256 (V256A)
Ref Sequence ENSEMBL: ENSMUSP00000025590 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025590]
Predicted Effect possibly damaging
Transcript: ENSMUST00000025590
AA Change: V256A

PolyPhen 2 Score 0.837 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000025590
Gene: ENSMUSG00000024687
AA Change: V256A

DomainStartEndE-ValueType
PH 87 181 1.21e-21 SMART
low complexity region 187 196 N/A INTRINSIC
coiled coil region 288 324 N/A INTRINSIC
PDB:2RR3|B 344 377 3e-16 PDB
Pfam:Oxysterol_BP 416 791 8.8e-146 PFAM
Meta Mutation Damage Score 0.158 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.5%
  • 20x: 89.9%
Validation Efficiency 88% (50/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Oxysterol binding protein is an intracellular protein that is believed to transport sterols from lysosomes to the nucleus where the sterol down-regulates the genes for the LDL receptor, HMG-CoA reductase, and HMG synthetase [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik A T 1: 26,683,782 N772K probably benign Het
Acot12 A C 13: 91,771,828 D294A probably benign Het
Adamts9 T C 6: 92,943,085 D24G probably benign Het
Ahnak G A 19: 9,006,680 G1776D probably damaging Het
Arfgef3 C A 10: 18,597,407 C1636F probably damaging Het
AW551984 A G 9: 39,590,644 L722P probably damaging Het
Ccndbp1 T A 2: 121,012,422 M188K probably damaging Het
Col27a1 A T 4: 63,265,633 probably null Het
Cpt1c A G 7: 44,966,671 Y306H probably damaging Het
Cyp3a57 A G 5: 145,362,102 I71V probably benign Het
Def8 G A 8: 123,456,495 A278T probably damaging Het
Dmrt2 A T 19: 25,678,291 Q418L possibly damaging Het
Ebf1 T C 11: 44,908,000 L284S probably damaging Het
Fam131a G A 16: 20,698,988 A15T probably benign Het
Fbxo17 A G 7: 28,733,491 T146A possibly damaging Het
Fer1l6 A G 15: 58,558,402 E226G probably damaging Het
Galnt18 A T 7: 111,599,031 I174N probably damaging Het
Gm13088 T C 4: 143,654,568 Y295C probably benign Het
Gm44501 T C 17: 40,578,853 I86T probably benign Het
Gm884 A C 11: 103,613,686 I2485M probably damaging Het
Gtsf1l T C 2: 163,087,326 Q79R probably benign Het
Hapln4 T C 8: 70,088,280 L321P probably damaging Het
Herc2 A G 7: 56,121,561 T1024A probably benign Het
Hps5 A G 7: 46,789,181 S43P probably damaging Het
Igsf10 A G 3: 59,330,832 Y643H probably damaging Het
Lama4 G A 10: 39,092,278 R1472H probably benign Het
Lhx9 A G 1: 138,840,006 Y73H possibly damaging Het
Loxl1 T A 9: 58,312,132 Q252L probably damaging Het
Nfat5 C T 8: 107,339,075 R156W probably damaging Het
Nr3c2 T A 8: 76,908,408 V46D probably damaging Het
Olfr1283 T A 2: 111,369,490 I286N probably damaging Het
Olfr152 C G 2: 87,782,705 P55R possibly damaging Het
Olfr487 A C 7: 108,212,003 N175K possibly damaging Het
Olfr495 A T 7: 108,395,368 N83Y probably benign Het
Olfr749 T C 14: 50,736,383 S260G possibly damaging Het
Pclo A T 5: 14,791,922 D4737V unknown Het
Pkdrej A G 15: 85,815,630 I2035T probably damaging Het
Plek2 A G 12: 78,894,504 S185P probably damaging Het
Pnpla6 G T 8: 3,532,117 probably null Het
Pou3f2 T C 4: 22,487,210 T308A possibly damaging Het
Pxmp4 A G 2: 154,592,295 V82A probably damaging Het
Rnf6 A T 5: 146,211,835 N135K possibly damaging Het
Rtl1 A G 12: 109,592,948 V819A probably damaging Het
Scn1a C A 2: 66,289,062 V1355L probably damaging Het
Scn2a T A 2: 65,711,816 N754K probably benign Het
Serpina3b A T 12: 104,130,771 N104Y probably damaging Het
Sh3rf2 T C 18: 42,156,057 S648P probably benign Het
Slc17a6 G A 7: 51,669,067 V486I probably benign Het
Syne2 T G 12: 75,941,298 D1743E probably damaging Het
Tex14 T G 11: 87,493,031 probably null Het
Tfb1m T C 17: 3,554,957 D87G probably damaging Het
Tll2 C T 19: 41,097,912 G609S probably damaging Het
Tsc22d2 A T 3: 58,417,156 probably benign Het
Tsen2 A G 6: 115,568,829 D360G probably damaging Het
Ugt2b37 G A 5: 87,240,983 P457L probably damaging Het
Vmn1r68 T C 7: 10,527,325 N282S possibly damaging Het
Vmn2r58 G A 7: 41,861,885 S498F probably benign Het
Zfp959 T C 17: 55,898,139 I392T probably benign Het
Other mutations in Osbp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01971:Osbp APN 19 11990635 missense probably benign 0.00
R0025:Osbp UTSW 19 11983958 missense probably damaging 1.00
R0025:Osbp UTSW 19 11983958 missense probably damaging 1.00
R0764:Osbp UTSW 19 11984156 splice site probably benign
R1583:Osbp UTSW 19 11977829 missense probably benign 0.18
R1808:Osbp UTSW 19 11970778 missense probably damaging 1.00
R1853:Osbp UTSW 19 11973891 missense possibly damaging 0.48
R2007:Osbp UTSW 19 11973901 missense probably benign 0.31
R2291:Osbp UTSW 19 11973834 nonsense probably null
R3788:Osbp UTSW 19 11978921 missense probably benign 0.00
R4082:Osbp UTSW 19 11978666 missense probably benign
R5240:Osbp UTSW 19 11978290 missense probably damaging 1.00
R5413:Osbp UTSW 19 11984491 missense probably damaging 1.00
R5825:Osbp UTSW 19 11970721 missense probably damaging 0.98
R5907:Osbp UTSW 19 11973876 missense probably damaging 1.00
R6255:Osbp UTSW 19 11977953 missense possibly damaging 0.64
R7226:Osbp UTSW 19 11978667 missense probably benign
X0024:Osbp UTSW 19 11978291 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAGCCTAACCTTGGCATCCCTAC -3'
(R):5'- ACTTAAAGCACCCGATGATGGAAGC -3'

Sequencing Primer
(F):5'- TCCCTACAGATGACTCAGGAGATG -3'
(R):5'- AGCAAGACCTGGTATATTCAGTG -3'
Posted On2013-04-16