Incidental Mutation 'R2018:Syne2'
ID223488
Institutional Source Beutler Lab
Gene Symbol Syne2
Ensembl Gene ENSMUSG00000063450
Gene Namespectrin repeat containing, nuclear envelope 2
Synonymssyne-2, D12Ertd777e, nesprin-2, 6820443O06Rik, Nesp2g
MMRRC Submission 040027-MU
Accession Numbers

Genbank: NM_001005510

Is this an essential gene? Possibly non essential (E-score: 0.335) question?
Stock #R2018 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location75818134-76110926 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 76074579 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 5940 (I5940F)
Ref Sequence ENSEMBL: ENSMUSP00000119120 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044217] [ENSMUST00000085280] [ENSMUST00000131480] [ENSMUST00000143031]
Predicted Effect probably damaging
Transcript: ENSMUST00000044217
AA Change: I5939F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000047697
Gene: ENSMUSG00000063450
AA Change: I5939F

DomainStartEndE-ValueType
CH 33 134 7.97e-19 SMART
low complexity region 151 175 N/A INTRINSIC
CH 185 283 1.34e-20 SMART
low complexity region 494 505 N/A INTRINSIC
coiled coil region 541 572 N/A INTRINSIC
low complexity region 665 674 N/A INTRINSIC
coiled coil region 844 869 N/A INTRINSIC
coiled coil region 936 969 N/A INTRINSIC
coiled coil region 1006 1032 N/A INTRINSIC
SPEC 1427 1525 4.96e0 SMART
SPEC 1528 1632 2.48e-1 SMART
coiled coil region 1660 1699 N/A INTRINSIC
SPEC 2034 2131 1.83e0 SMART
coiled coil region 2173 2194 N/A INTRINSIC
low complexity region 2295 2307 N/A INTRINSIC
coiled coil region 2316 2348 N/A INTRINSIC
SPEC 2720 2820 1.44e-5 SMART
coiled coil region 2905 2934 N/A INTRINSIC
coiled coil region 2962 2989 N/A INTRINSIC
coiled coil region 3108 3136 N/A INTRINSIC
low complexity region 3333 3350 N/A INTRINSIC
low complexity region 3514 3523 N/A INTRINSIC
low complexity region 3666 3676 N/A INTRINSIC
coiled coil region 3678 3708 N/A INTRINSIC
coiled coil region 3761 3788 N/A INTRINSIC
coiled coil region 3846 3903 N/A INTRINSIC
coiled coil region 4015 4067 N/A INTRINSIC
low complexity region 4102 4115 N/A INTRINSIC
coiled coil region 4483 4511 N/A INTRINSIC
low complexity region 4557 4569 N/A INTRINSIC
coiled coil region 4655 4688 N/A INTRINSIC
low complexity region 4749 4763 N/A INTRINSIC
SPEC 4827 4926 5.25e-1 SMART
SPEC 4933 5038 2.64e-4 SMART
SPEC 5048 5152 1.47e-2 SMART
SPEC 5159 5259 4.29e0 SMART
SPEC 5263 5371 4.47e0 SMART
low complexity region 5373 5393 N/A INTRINSIC
SPEC 5583 5681 5.7e-1 SMART
Blast:SPEC 5690 5793 2e-53 BLAST
SPEC 5800 5900 2.11e0 SMART
SPEC 5907 6005 6.91e-8 SMART
SPEC 6012 6119 4.45e-11 SMART
SPEC 6126 6228 6.39e-12 SMART
SPEC 6235 6335 7.75e-11 SMART
SPEC 6539 6642 5.53e-7 SMART
SPEC 6649 6753 5.12e-2 SMART
KASH 6817 6874 8.17e-34 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000085280
AA Change: I1200F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000082383
Gene: ENSMUSG00000063450
AA Change: I1200F

DomainStartEndE-ValueType
low complexity region 10 24 N/A INTRINSIC
SPEC 88 187 5.25e-1 SMART
SPEC 194 299 2.64e-4 SMART
SPEC 309 413 1.47e-2 SMART
SPEC 420 520 4.29e0 SMART
SPEC 524 632 4.47e0 SMART
low complexity region 634 654 N/A INTRINSIC
SPEC 844 942 5.7e-1 SMART
Blast:SPEC 951 1054 2e-53 BLAST
SPEC 1061 1161 2.11e0 SMART
SPEC 1168 1266 6.91e-8 SMART
SPEC 1273 1380 4.45e-11 SMART
SPEC 1387 1489 6.39e-12 SMART
SPEC 1496 1596 7.75e-11 SMART
SPEC 1823 1926 5.53e-7 SMART
SPEC 1933 2037 5.12e-2 SMART
KASH 2095 2152 8.17e-34 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000131480
AA Change: I102F

PolyPhen 2 Score 0.940 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000114364
Gene: ENSMUSG00000063450
AA Change: I102F

DomainStartEndE-ValueType
Blast:SPEC 1 63 3e-33 BLAST
SPEC 70 168 6.91e-8 SMART
SPEC 175 269 3.46e-1 SMART
Predicted Effect unknown
Transcript: ENSMUST00000139204
AA Change: I714F
SMART Domains Protein: ENSMUSP00000118921
Gene: ENSMUSG00000063450
AA Change: I714F

DomainStartEndE-ValueType
SPEC 39 147 4.47e0 SMART
low complexity region 149 169 N/A INTRINSIC
SPEC 359 457 5.7e-1 SMART
Blast:SPEC 466 569 3e-53 BLAST
SPEC 576 676 2.11e0 SMART
SPEC 683 781 6.91e-8 SMART
SPEC 788 895 4.45e-11 SMART
SPEC 902 1004 6.39e-12 SMART
SPEC 1011 1111 7.75e-11 SMART
SPEC 1315 1418 5.53e-7 SMART
SPEC 1425 1529 5.12e-2 SMART
KASH 1587 1644 8.17e-34 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000143031
AA Change: I5940F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000119120
Gene: ENSMUSG00000063450
AA Change: I5940F

DomainStartEndE-ValueType
CH 33 134 7.97e-19 SMART
low complexity region 151 175 N/A INTRINSIC
CH 185 283 1.34e-20 SMART
low complexity region 494 505 N/A INTRINSIC
coiled coil region 541 572 N/A INTRINSIC
coiled coil region 845 870 N/A INTRINSIC
coiled coil region 937 970 N/A INTRINSIC
coiled coil region 1007 1033 N/A INTRINSIC
SPEC 1428 1526 4.96e0 SMART
SPEC 1529 1633 2.48e-1 SMART
coiled coil region 1661 1700 N/A INTRINSIC
SPEC 2035 2132 1.83e0 SMART
coiled coil region 2174 2195 N/A INTRINSIC
low complexity region 2296 2308 N/A INTRINSIC
coiled coil region 2317 2349 N/A INTRINSIC
SPEC 2721 2821 1.44e-5 SMART
coiled coil region 2906 2935 N/A INTRINSIC
coiled coil region 2963 2990 N/A INTRINSIC
coiled coil region 3109 3137 N/A INTRINSIC
low complexity region 3334 3351 N/A INTRINSIC
low complexity region 3515 3524 N/A INTRINSIC
low complexity region 3667 3677 N/A INTRINSIC
coiled coil region 3679 3709 N/A INTRINSIC
coiled coil region 3762 3789 N/A INTRINSIC
coiled coil region 3847 3904 N/A INTRINSIC
coiled coil region 4016 4068 N/A INTRINSIC
low complexity region 4103 4116 N/A INTRINSIC
coiled coil region 4484 4512 N/A INTRINSIC
low complexity region 4558 4570 N/A INTRINSIC
coiled coil region 4656 4689 N/A INTRINSIC
low complexity region 4750 4764 N/A INTRINSIC
SPEC 4828 4927 5.25e-1 SMART
SPEC 4934 5039 2.64e-4 SMART
SPEC 5049 5153 1.47e-2 SMART
SPEC 5160 5260 4.29e0 SMART
SPEC 5264 5372 4.47e0 SMART
low complexity region 5374 5394 N/A INTRINSIC
SPEC 5584 5682 5.7e-1 SMART
Blast:SPEC 5691 5794 2e-53 BLAST
SPEC 5801 5901 2.11e0 SMART
SPEC 5908 6006 6.91e-8 SMART
SPEC 6013 6120 4.45e-11 SMART
SPEC 6127 6229 6.39e-12 SMART
SPEC 6236 6336 7.75e-11 SMART
SPEC 6540 6643 5.53e-7 SMART
SPEC 6650 6754 5.12e-2 SMART
KASH 6813 6870 8.17e-34 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a nuclear outer membrane protein that binds cytoplasmic F-actin. This binding tethers the nucleus to the cytoskeleton and aids in the maintenance of the structural integrity of the nucleus. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2009]
PHENOTYPE: Homozygotes for one knock-out allele show normal myonuclear positioning of both synaptic and non-synaptic nuclei in skeletal muscle cells. Homozygotes for another knock-out allele exhibit a thickened epidermis and altered nuclear envelope architecture inprimary dermal fibroblasts and keratinocytes. Mice homozygous for a spontaneous mutation exhibit early retinal defects in photoreceptors, secondary Neurons, and muller glia. [provided by MGI curators]
Allele List at MGI

 All alleles(5) : Targeted, knock-out(2) Gene trapped(3)

Other mutations in this stock
Total: 111 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610028H24Rik C A 10: 76,458,065 F252L possibly damaging Het
4921501E09Rik T C 17: 33,066,967 N287S probably benign Het
4930447A16Rik T G 15: 37,440,498 probably benign Het
Abca14 A T 7: 120,216,185 M219L probably benign Het
Abi3bp A G 16: 56,677,796 T918A probably damaging Het
Acss3 C T 10: 106,936,207 S669N probably benign Het
Adamts16 G A 13: 70,779,518 probably benign Het
Adamtsl4 A G 3: 95,681,102 Y559H probably damaging Het
Adgrg5 T A 8: 94,934,480 M106K probably damaging Het
Akt1 T C 12: 112,659,625 N71S probably damaging Het
Amer2 A C 14: 60,378,445 K30Q probably damaging Het
Anapc5 T C 5: 122,800,524 K383E probably damaging Het
Ano1 A G 7: 144,654,250 L258P probably damaging Het
Arhgef10l A G 4: 140,544,384 S560P probably damaging Het
Arhgef40 T A 14: 52,003,705 L1395Q probably damaging Het
Arid1a A T 4: 133,681,834 D1787E unknown Het
C77080 A G 4: 129,222,355 S884P probably damaging Het
Ces2h T C 8: 105,018,398 L388P probably damaging Het
Cfap54 T A 10: 93,016,604 N880I probably benign Het
Cryz T C 3: 154,621,683 V116A probably damaging Het
Csrp1 G A 1: 135,750,628 A159T probably damaging Het
Cttnbp2 A G 6: 18,434,518 F447S probably damaging Het
Cyp4a12a A T 4: 115,327,505 I328F probably damaging Het
Cyth4 T G 15: 78,608,171 H133Q probably damaging Het
Ddah2 A G 17: 35,060,426 I88V possibly damaging Het
Dmbt1 T G 7: 131,110,989 I1563S possibly damaging Het
Dnajc22 T C 15: 99,101,233 S100P probably benign Het
Fam172a A G 13: 77,999,637 T321A possibly damaging Het
Fancl T A 11: 26,422,459 D123E probably damaging Het
Fbxo30 A G 10: 11,291,028 Q498R probably damaging Het
Fgd4 T C 16: 16,435,960 H581R probably benign Het
Gm2663 T C 6: 40,997,966 Q57R probably benign Het
Gm5065 A G 7: 5,359,574 D68G probably benign Het
Gm7247 A T 14: 51,365,347 M47L possibly damaging Het
Gsdmc2 T A 15: 63,828,126 probably null Het
Hc A C 2: 35,013,528 F1038C probably damaging Het
Heatr1 C A 13: 12,414,478 Q890K possibly damaging Het
Hipk4 C A 7: 27,529,004 T293K probably damaging Het
Hp1bp3 C A 4: 138,221,632 A2E probably damaging Het
Il6 T C 5: 30,014,947 probably null Het
Itga6 A G 2: 71,818,484 D104G probably benign Het
Krt24 A G 11: 99,282,451 S293P probably damaging Het
Krt4 C T 15: 101,920,651 R309Q probably damaging Het
Krt40 A T 11: 99,540,087 W199R probably damaging Het
Lamc1 T C 1: 153,242,632 E931G probably benign Het
Lamp3 A T 16: 19,701,211 M74K probably benign Het
Magel2 G A 7: 62,379,096 V583I unknown Het
March7 T A 2: 60,229,040 Y37* probably null Het
Mrpl36 A G 13: 73,331,568 K66E probably damaging Het
Mrps35 G T 6: 147,061,484 E229* probably null Het
Mtmr6 T C 14: 60,298,992 M557T probably benign Het
Myocd A T 11: 65,187,028 I647N probably damaging Het
Myom2 A C 8: 15,131,151 L1350F probably damaging Het
Nosip T A 7: 45,076,609 S197T probably benign Het
Npat A G 9: 53,562,491 K528E probably benign Het
Nyap2 A G 1: 81,191,872 T115A probably benign Het
Olfr1032 A T 2: 86,008,223 Y149F probably damaging Het
Olfr1214 G T 2: 88,988,145 P19Q probably benign Het
Olfr122 A G 17: 37,772,576 R317G probably benign Het
Olfr1245 A G 2: 89,575,393 V111A probably damaging Het
Olfr65 T A 7: 103,907,042 V201D possibly damaging Het
Olfr972 A G 9: 39,874,058 Q261R probably benign Het
Orc1 T C 4: 108,590,700 V48A possibly damaging Het
Pde6d T C 1: 86,546,716 E69G probably damaging Het
Pdgfrb A T 18: 61,083,334 D1088V possibly damaging Het
Peg12 A G 7: 62,463,638 V237A probably benign Het
Piezo1 A G 8: 122,482,712 F2371L probably benign Het
Podn T A 4: 108,023,373 S27C probably damaging Het
Pom121l2 A G 13: 21,982,734 M392V possibly damaging Het
Ppm1b A G 17: 84,994,202 K170R probably damaging Het
Rab18 A T 18: 6,770,113 probably null Het
Raet1d G A 10: 22,371,012 A80T probably damaging Het
Rfx7 T A 9: 72,617,685 V719E probably benign Het
Rnf219 T A 14: 104,522,542 K24M probably damaging Het
Ror1 C T 4: 100,407,841 Q171* probably null Het
Rufy4 G A 1: 74,140,947 V454M possibly damaging Het
Ryr2 C T 13: 11,851,188 G292D possibly damaging Het
Ryr3 G T 2: 112,781,065 N2257K probably benign Het
Saal1 A G 7: 46,699,489 F306S possibly damaging Het
Sap18 A G 14: 57,798,564 N69S probably damaging Het
Sar1b A T 11: 51,779,687 probably null Het
Serpina3n G T 12: 104,409,214 V182L probably damaging Het
Setd3 A T 12: 108,118,254 H279Q probably damaging Het
Slc18a2 C A 19: 59,276,505 A307E possibly damaging Het
Slc4a10 A T 2: 62,234,381 D193V probably damaging Het
Spire2 T C 8: 123,332,918 C52R probably damaging Het
Sytl1 C T 4: 133,256,160 S355N probably damaging Het
Tarbp1 C T 8: 126,428,114 V1424I probably damaging Het
Tatdn3 A T 1: 191,049,280 probably null Het
Tbpl1 T A 10: 22,707,677 E131D probably damaging Het
Telo2 A T 17: 25,105,408 M501K probably damaging Het
Terb1 A G 8: 104,452,699 V619A probably benign Het
Tmem132e A G 11: 82,445,163 T1024A probably benign Het
Tmem30a T C 9: 79,774,218 D223G probably damaging Het
Tmprss11d A G 5: 86,339,554 V19A probably damaging Het
Tnks A T 8: 34,851,106 S872T probably damaging Het
Tnxb A G 17: 34,671,750 S356G probably benign Het
Tob2 T C 15: 81,851,199 K190E probably damaging Het
Togaram1 T C 12: 65,002,659 V1240A possibly damaging Het
Trim13 T A 14: 61,604,886 C117* probably null Het
Trpv4 G A 5: 114,634,605 R308C probably damaging Het
Ttn C G 2: 76,755,332 D21987H probably damaging Het
Ttn C A 2: 76,826,074 probably null Het
Upp1 A T 11: 9,133,240 M111L possibly damaging Het
Vmn1r206 A T 13: 22,620,188 V283E probably damaging Het
Vmn2r79 G T 7: 87,002,426 L344F probably benign Het
Vmn2r93 T G 17: 18,326,062 I732S probably damaging Het
Vmn2r96 G T 17: 18,584,001 M504I probably benign Het
Vps39 T C 2: 120,343,227 Y147C probably damaging Het
Zbtb20 T A 16: 43,577,652 C35S possibly damaging Het
Zfp871 A T 17: 32,774,777 C475S probably damaging Het
Other mutations in Syne2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00329:Syne2 APN 12 76031700 unclassified probably benign
IGL00595:Syne2 APN 12 75925646 missense possibly damaging 0.76
IGL00672:Syne2 APN 12 76064184 missense probably damaging 1.00
IGL00781:Syne2 APN 12 76024062 missense probably benign 0.00
IGL00823:Syne2 APN 12 75989242 missense probably damaging 0.98
IGL01014:Syne2 APN 12 75905277 missense probably damaging 0.99
IGL01074:Syne2 APN 12 76031587 nonsense probably null
IGL01074:Syne2 APN 12 75987011 missense probably benign 0.00
IGL01324:Syne2 APN 12 76043752 missense probably damaging 1.00
IGL01325:Syne2 APN 12 75926514 missense probably benign 0.01
IGL01331:Syne2 APN 12 75929253 splice site probably benign
IGL01338:Syne2 APN 12 76060226 missense possibly damaging 0.55
IGL01373:Syne2 APN 12 75987107 missense probably damaging 1.00
IGL01446:Syne2 APN 12 76041375 missense probably damaging 1.00
IGL01556:Syne2 APN 12 76087815 missense probably damaging 1.00
IGL01585:Syne2 APN 12 75949060 critical splice acceptor site probably null
IGL01629:Syne2 APN 12 76004603 missense possibly damaging 0.49
IGL01686:Syne2 APN 12 75909336 missense probably benign
IGL01935:Syne2 APN 12 75925313 missense probably damaging 1.00
IGL01941:Syne2 APN 12 75967220 missense probably benign 0.01
IGL01956:Syne2 APN 12 76097974 missense probably damaging 1.00
IGL01967:Syne2 APN 12 75941303 missense probably damaging 1.00
IGL01990:Syne2 APN 12 76054933 missense probably damaging 1.00
IGL02000:Syne2 APN 12 76015645 missense probably damaging 0.99
IGL02063:Syne2 APN 12 76052100 missense probably damaging 0.96
IGL02069:Syne2 APN 12 75927412 missense probably benign 0.13
IGL02120:Syne2 APN 12 75946706 missense probably damaging 1.00
IGL02222:Syne2 APN 12 75952843 missense probably damaging 0.96
IGL02223:Syne2 APN 12 76108305 missense probably benign 0.00
IGL02321:Syne2 APN 12 75918999 missense possibly damaging 0.58
IGL02488:Syne2 APN 12 75965738 missense probably benign 0.24
IGL02491:Syne2 APN 12 76072179 missense probably benign 0.10
IGL02525:Syne2 APN 12 76101003 missense probably damaging 0.99
IGL02578:Syne2 APN 12 76022279 missense possibly damaging 0.76
IGL02615:Syne2 APN 12 76096994 missense probably damaging 1.00
IGL02702:Syne2 APN 12 76097924 missense probably damaging 1.00
IGL02726:Syne2 APN 12 76015582 missense probably damaging 0.99
IGL02795:Syne2 APN 12 75966549 missense probably damaging 0.99
IGL02803:Syne2 APN 12 76031546 missense probably damaging 1.00
IGL02814:Syne2 APN 12 75945376 missense possibly damaging 0.64
IGL03013:Syne2 APN 12 75929337 missense probably benign 0.00
IGL03131:Syne2 APN 12 76057490 missense probably damaging 1.00
IGL03152:Syne2 APN 12 75965712 missense probably benign 0.12
IGL03216:Syne2 APN 12 75942961 splice site probably benign
IGL03228:Syne2 APN 12 75979912 missense probably benign 0.01
IGL03259:Syne2 APN 12 75989079 missense probably benign 0.05
IGL03374:Syne2 APN 12 76074586 missense possibly damaging 0.66
IGL03375:Syne2 APN 12 75925435 missense possibly damaging 0.57
3-1:Syne2 UTSW 12 75930632 missense probably benign 0.02
B5639:Syne2 UTSW 12 75929790 missense probably benign
K3955:Syne2 UTSW 12 75930665 missense probably damaging 1.00
P0026:Syne2 UTSW 12 75880220 splice site probably benign
R0089:Syne2 UTSW 12 75963876 missense probably damaging 1.00
R0110:Syne2 UTSW 12 76097960 nonsense probably null
R0113:Syne2 UTSW 12 75930578 missense probably damaging 1.00
R0113:Syne2 UTSW 12 76033722 missense probably damaging 1.00
R0141:Syne2 UTSW 12 75941298 missense probably damaging 1.00
R0211:Syne2 UTSW 12 76097957 missense probably damaging 1.00
R0219:Syne2 UTSW 12 76042004 missense probably damaging 1.00
R0242:Syne2 UTSW 12 76098034 missense probably damaging 1.00
R0242:Syne2 UTSW 12 76098034 missense probably damaging 1.00
R0279:Syne2 UTSW 12 76095613 missense probably damaging 1.00
R0319:Syne2 UTSW 12 76064162 missense probably damaging 0.99
R0325:Syne2 UTSW 12 75962641 missense probably benign 0.00
R0329:Syne2 UTSW 12 75966953 missense probably benign
R0330:Syne2 UTSW 12 75966953 missense probably benign
R0361:Syne2 UTSW 12 75918610 missense probably benign 0.22
R0363:Syne2 UTSW 12 76072207 missense probably damaging 0.98
R0367:Syne2 UTSW 12 75880177 missense probably damaging 1.00
R0371:Syne2 UTSW 12 75933845 missense probably damaging 1.00
R0374:Syne2 UTSW 12 75921226 nonsense probably null
R0388:Syne2 UTSW 12 75986975 missense probably benign 0.41
R0411:Syne2 UTSW 12 76059584 splice site probably null
R0432:Syne2 UTSW 12 75949064 missense probably damaging 0.99
R0469:Syne2 UTSW 12 75854149 critical splice donor site probably null
R0492:Syne2 UTSW 12 75982063 critical splice donor site probably null
R0496:Syne2 UTSW 12 76038940 missense possibly damaging 0.80
R0504:Syne2 UTSW 12 76033591 splice site probably benign
R0505:Syne2 UTSW 12 76099464 missense probably damaging 1.00
R0510:Syne2 UTSW 12 75854149 critical splice donor site probably null
R0518:Syne2 UTSW 12 76108862 critical splice acceptor site probably null
R0539:Syne2 UTSW 12 76024121 missense possibly damaging 0.69
R0552:Syne2 UTSW 12 75931004 missense probably benign 0.00
R0557:Syne2 UTSW 12 75929301 missense probably benign 0.04
R0567:Syne2 UTSW 12 75890230 missense probably damaging 0.98
R0599:Syne2 UTSW 12 76097960 nonsense probably null
R0602:Syne2 UTSW 12 76097960 nonsense probably null
R0608:Syne2 UTSW 12 75963813 missense probably damaging 1.00
R0614:Syne2 UTSW 12 75912353 unclassified probably null
R0636:Syne2 UTSW 12 75930983 missense possibly damaging 0.75
R0647:Syne2 UTSW 12 75888203 missense probably benign
R0654:Syne2 UTSW 12 76097960 nonsense probably null
R0658:Syne2 UTSW 12 76094336 missense probably damaging 1.00
R0666:Syne2 UTSW 12 75923013 missense probably damaging 0.99
R0707:Syne2 UTSW 12 75982063 critical splice donor site probably null
R0714:Syne2 UTSW 12 76097960 nonsense probably null
R0841:Syne2 UTSW 12 76074435 splice site probably benign
R0848:Syne2 UTSW 12 76097959 frame shift probably null
R0848:Syne2 UTSW 12 76097960 nonsense probably null
R1077:Syne2 UTSW 12 76042035 missense possibly damaging 0.94
R1103:Syne2 UTSW 12 76109835 missense probably benign 0.00
R1144:Syne2 UTSW 12 75966524 missense probably benign 0.04
R1194:Syne2 UTSW 12 75934513 missense probably damaging 1.00
R1247:Syne2 UTSW 12 75967490 missense probably benign 0.39
R1276:Syne2 UTSW 12 75941189 critical splice acceptor site probably null
R1343:Syne2 UTSW 12 76033643 missense probably damaging 1.00
R1442:Syne2 UTSW 12 75946715 missense probably damaging 1.00
R1448:Syne2 UTSW 12 76020325 splice site probably null
R1448:Syne2 UTSW 12 76052178 missense possibly damaging 0.56
R1522:Syne2 UTSW 12 76103783 missense probably damaging 0.98
R1528:Syne2 UTSW 12 75966100 missense probably benign 0.00
R1636:Syne2 UTSW 12 76004732 missense probably benign 0.01
R1637:Syne2 UTSW 12 75996002 missense probably damaging 1.00
R1650:Syne2 UTSW 12 75904259 nonsense probably null
R1654:Syne2 UTSW 12 76101094 missense possibly damaging 0.56
R1714:Syne2 UTSW 12 76054939 missense probably benign 0.26
R1750:Syne2 UTSW 12 76052805 missense probably damaging 1.00
R1772:Syne2 UTSW 12 75938729 missense probably benign 0.19
R1797:Syne2 UTSW 12 75963783 missense probably benign 0.00
R1830:Syne2 UTSW 12 76109862 missense probably damaging 1.00
R1837:Syne2 UTSW 12 75967660 missense probably damaging 0.99
R1908:Syne2 UTSW 12 76094279 critical splice acceptor site probably null
R1913:Syne2 UTSW 12 75899246 missense possibly damaging 0.60
R1944:Syne2 UTSW 12 76074544 missense probably damaging 1.00
R1950:Syne2 UTSW 12 75952870 missense probably benign
R1958:Syne2 UTSW 12 75969545 missense probably benign 0.11
R2037:Syne2 UTSW 12 76025569 missense probably benign 0.04
R2067:Syne2 UTSW 12 75888342 critical splice donor site probably null
R2073:Syne2 UTSW 12 76015579 missense possibly damaging 0.54
R2099:Syne2 UTSW 12 75979973 missense probably benign 0.06
R2102:Syne2 UTSW 12 76028079 missense probably benign 0.01
R2134:Syne2 UTSW 12 75952786 missense probably damaging 0.99
R2135:Syne2 UTSW 12 75952786 missense probably damaging 0.99
R2157:Syne2 UTSW 12 76094456 missense probably damaging 1.00
R2173:Syne2 UTSW 12 76100989 splice site probably benign
R2248:Syne2 UTSW 12 76096904 missense probably damaging 1.00
R2276:Syne2 UTSW 12 75927466 missense possibly damaging 0.87
R2277:Syne2 UTSW 12 75927466 missense possibly damaging 0.87
R2278:Syne2 UTSW 12 75927466 missense possibly damaging 0.87
R2279:Syne2 UTSW 12 75927466 missense possibly damaging 0.87
R2483:Syne2 UTSW 12 76095537 missense probably damaging 1.00
R2877:Syne2 UTSW 12 76000831 missense probably benign 0.00
R2884:Syne2 UTSW 12 75963759 missense probably benign 0.00
R3119:Syne2 UTSW 12 75909284 missense probably benign 0.01
R3499:Syne2 UTSW 12 76054978 splice site probably null
R3827:Syne2 UTSW 12 75987031 missense probably benign 0.02
R3847:Syne2 UTSW 12 76048622 missense probably damaging 1.00
R3849:Syne2 UTSW 12 76046065 nonsense probably null
R3850:Syne2 UTSW 12 76048622 missense probably damaging 1.00
R3859:Syne2 UTSW 12 75929784 missense possibly damaging 0.55
R3861:Syne2 UTSW 12 75966479 missense probably damaging 0.98
R4078:Syne2 UTSW 12 76035624 missense probably damaging 1.00
R4116:Syne2 UTSW 12 75931079 missense probably damaging 1.00
R4326:Syne2 UTSW 12 75952742 missense probably damaging 1.00
R4335:Syne2 UTSW 12 76028092 missense probably damaging 1.00
R4410:Syne2 UTSW 12 76094393 missense probably damaging 1.00
R4412:Syne2 UTSW 12 76106060 missense probably benign 0.01
R4444:Syne2 UTSW 12 76023030 missense probably damaging 1.00
R4595:Syne2 UTSW 12 75967071 missense possibly damaging 0.88
R4604:Syne2 UTSW 12 75967710 missense probably damaging 0.99
R4606:Syne2 UTSW 12 75989253 missense probably damaging 1.00
R4651:Syne2 UTSW 12 75989239 missense probably damaging 0.99
R4656:Syne2 UTSW 12 76031373 missense probably damaging 1.00
R4675:Syne2 UTSW 12 75949301 missense probably damaging 1.00
R4790:Syne2 UTSW 12 76020391 missense probably benign 0.19
R4791:Syne2 UTSW 12 75909244 missense possibly damaging 0.96
R4799:Syne2 UTSW 12 75899167 missense probably benign 0.04
R4836:Syne2 UTSW 12 75979819 missense probably damaging 1.00
R4880:Syne2 UTSW 12 75979819 missense probably damaging 1.00
R4881:Syne2 UTSW 12 75979819 missense probably damaging 1.00
R4899:Syne2 UTSW 12 75854101 missense probably benign 0.03
R4934:Syne2 UTSW 12 75899272 missense probably benign 0.14
R4981:Syne2 UTSW 12 75941219 missense probably damaging 0.98
R4996:Syne2 UTSW 12 75943950 missense possibly damaging 0.87
R5056:Syne2 UTSW 12 75909131 unclassified probably benign
R5066:Syne2 UTSW 12 75966551 missense probably benign 0.05
R5095:Syne2 UTSW 12 75952826 missense probably damaging 0.99
R5151:Syne2 UTSW 12 76043710 missense probably benign 0.06
R5193:Syne2 UTSW 12 76094420 missense probably damaging 1.00
R5267:Syne2 UTSW 12 75938741 missense possibly damaging 0.74
R5288:Syne2 UTSW 12 76099338 missense possibly damaging 0.94
R5402:Syne2 UTSW 12 76059439 missense probably damaging 0.98
R5434:Syne2 UTSW 12 75971875 missense probably damaging 1.00
R5441:Syne2 UTSW 12 75989143 missense possibly damaging 0.75
R5488:Syne2 UTSW 12 75888172 missense probably benign 0.13
R5497:Syne2 UTSW 12 75880389 missense probably benign 0.19
R5506:Syne2 UTSW 12 75938721 missense probably benign 0.01
R5509:Syne2 UTSW 12 75921244 missense probably damaging 1.00
R5518:Syne2 UTSW 12 75945170 missense possibly damaging 0.88
R5561:Syne2 UTSW 12 76094458 nonsense probably null
R5581:Syne2 UTSW 12 75945085 missense probably benign 0.01
R5625:Syne2 UTSW 12 76095112 missense probably benign 0.06
R5642:Syne2 UTSW 12 75918532 missense probably damaging 1.00
R5665:Syne2 UTSW 12 76108217 critical splice donor site probably null
R5666:Syne2 UTSW 12 75950959 missense probably benign 0.16
R5670:Syne2 UTSW 12 75950959 missense probably benign 0.16
R5691:Syne2 UTSW 12 76027856 frame shift probably null
R5696:Syne2 UTSW 12 75994145 missense probably benign 0.00
R5720:Syne2 UTSW 12 75967667 missense probably benign 0.03
R5739:Syne2 UTSW 12 75997465 missense possibly damaging 0.53
R5840:Syne2 UTSW 12 75880291 intron probably null
R5846:Syne2 UTSW 12 76028124 missense probably benign 0.01
R5850:Syne2 UTSW 12 76097975 missense probably damaging 1.00
R5889:Syne2 UTSW 12 76072252 nonsense probably null
R5912:Syne2 UTSW 12 75908947 critical splice donor site probably null
R5931:Syne2 UTSW 12 76008865 missense probably benign 0.37
R5985:Syne2 UTSW 12 75966159 missense probably damaging 0.96
R5988:Syne2 UTSW 12 75929417 critical splice donor site probably null
R5990:Syne2 UTSW 12 76024144 missense probably benign 0.10
R6038:Syne2 UTSW 12 75878384 nonsense probably null
R6038:Syne2 UTSW 12 75878384 nonsense probably null
R6132:Syne2 UTSW 12 75945147 missense probably benign 0.14
R6136:Syne2 UTSW 12 75905325 missense probably benign 0.24
R6229:Syne2 UTSW 12 75921220 missense probably benign 0.00
R6252:Syne2 UTSW 12 75969436 missense probably benign 0.39
R6271:Syne2 UTSW 12 75890381 missense probably damaging 1.00
R6320:Syne2 UTSW 12 76061650 missense probably damaging 0.96
R6339:Syne2 UTSW 12 75989153 missense probably benign 0.34
R6380:Syne2 UTSW 12 76104980 missense probably damaging 0.98
R6394:Syne2 UTSW 12 75990495 missense probably benign 0.09
R6419:Syne2 UTSW 12 76096966 missense probably damaging 1.00
R6426:Syne2 UTSW 12 75923083 missense probably null 0.97
R6434:Syne2 UTSW 12 76041456 missense probably damaging 0.99
R6437:Syne2 UTSW 12 75990414 missense possibly damaging 0.87
R6466:Syne2 UTSW 12 75943901 missense probably damaging 0.97
R6501:Syne2 UTSW 12 76027847 unclassified probably null
R6552:Syne2 UTSW 12 75890241 missense possibly damaging 0.89
R6744:Syne2 UTSW 12 76074447 missense probably damaging 1.00
R6810:Syne2 UTSW 12 75942885 missense probably benign 0.00
R6831:Syne2 UTSW 12 75966794 missense probably benign 0.39
R6861:Syne2 UTSW 12 75909266 missense probably damaging 1.00
R6875:Syne2 UTSW 12 76035630 missense probably damaging 0.99
R6892:Syne2 UTSW 12 75962528 missense probably damaging 0.98
R6906:Syne2 UTSW 12 75995986 missense possibly damaging 0.93
R6909:Syne2 UTSW 12 76064195 missense probably benign 0.04
R6925:Syne2 UTSW 12 75854132 missense possibly damaging 0.58
R6949:Syne2 UTSW 12 75965997 missense probably benign 0.00
R6952:Syne2 UTSW 12 75927431 missense possibly damaging 0.76
X0019:Syne2 UTSW 12 75973287 missense probably benign 0.41
X0026:Syne2 UTSW 12 76101016 missense possibly damaging 0.78
X0061:Syne2 UTSW 12 75927511 critical splice donor site probably null
X0066:Syne2 UTSW 12 76096927 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGAGCCAAGGGATTTTCCTTC -3'
(R):5'- TCCACCTATGACAAGCTCATG -3'

Sequencing Primer
(F):5'- GGATTTTCCTTCCCTGCTATCCTCAG -3'
(R):5'- ATGCTTTCGCTCTCTCCCATG -3'
Posted On2014-08-25