Incidental Mutation 'R2018:Tnxb'
ID223557
Institutional Source Beutler Lab
Gene Symbol Tnxb
Ensembl Gene ENSMUSG00000033327
Gene Nametenascin XB
SynonymsTnx, TN-MHC
MMRRC Submission 040027-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2018 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location34670535-34719815 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 34671750 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 356 (S356G)
Ref Sequence ENSEMBL: ENSMUSP00000084661 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087399] [ENSMUST00000168533]
Predicted Effect probably benign
Transcript: ENSMUST00000087399
AA Change: S356G

PolyPhen 2 Score 0.036 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000084661
Gene: ENSMUSG00000033327
AA Change: S356G

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 33 44 N/A INTRINSIC
low complexity region 69 89 N/A INTRINSIC
low complexity region 92 103 N/A INTRINSIC
EGF 173 201 1.59e1 SMART
EGF 204 232 7.41e0 SMART
EGF 235 263 2.64e1 SMART
EGF 266 294 2.64e1 SMART
EGF 297 325 9.13e0 SMART
EGF 328 356 2.07e1 SMART
EGF_like 359 387 3.16e1 SMART
EGF_like 390 418 4.64e1 SMART
EGF_like 421 449 3.29e1 SMART
EGF_like 452 480 7.09e1 SMART
EGF 483 511 1.15e1 SMART
EGF 514 542 1.91e1 SMART
EGF_like 545 573 4.11e1 SMART
EGF 576 604 7.95e0 SMART
EGF 607 635 1.23e1 SMART
EGF_like 638 666 4.93e1 SMART
EGF_like 674 702 5.24e1 SMART
EGF 705 733 2.29e1 SMART
FN3 736 816 4.12e-3 SMART
FN3 827 904 1.21e-9 SMART
FN3 1047 1126 3.97e-5 SMART
FN3 1142 1223 3.62e-8 SMART
low complexity region 1230 1241 N/A INTRINSIC
FN3 1242 1320 2.31e-6 SMART
FN3 1351 1431 8.77e-7 SMART
FN3 1460 1539 3.01e-5 SMART
FN3 1556 1636 2.76e-4 SMART
FN3 1657 1736 5.78e-7 SMART
FN3 1752 1832 4.7e-7 SMART
FN3 1851 1929 1.95e-4 SMART
FN3 1955 2034 4.56e-5 SMART
FN3 2066 2145 2.23e-8 SMART
FN3 2164 2244 7.75e-8 SMART
FN3 2279 2358 8.5e-5 SMART
FN3 2387 2467 2.94e-8 SMART
FN3 2501 2580 1.7e-4 SMART
low complexity region 2588 2598 N/A INTRINSIC
FN3 2607 2687 6.75e-8 SMART
FN3 2716 2795 7.4e-5 SMART
FN3 2822 2902 1.35e-7 SMART
FN3 2931 3010 5.61e-5 SMART
FN3 3026 3106 6.01e-5 SMART
FN3 3120 3199 6.45e-5 SMART
FN3 3214 3293 9.54e-8 SMART
FN3 3316 3396 2.81e-5 SMART
FN3 3416 3502 1.98e-5 SMART
FN3 3518 3596 5.65e-10 SMART
FN3 3607 3682 7.63e-7 SMART
FN3 3695 3770 6.54e-6 SMART
FBG 3787 3997 8.88e-125 SMART
Predicted Effect unknown
Transcript: ENSMUST00000168533
AA Change: S356G
SMART Domains Protein: ENSMUSP00000127487
Gene: ENSMUSG00000033327
AA Change: S356G

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 33 44 N/A INTRINSIC
low complexity region 69 89 N/A INTRINSIC
low complexity region 92 103 N/A INTRINSIC
EGF 173 201 1.59e1 SMART
EGF 204 232 7.41e0 SMART
EGF 235 263 2.64e1 SMART
EGF 266 294 2.64e1 SMART
EGF 297 325 9.13e0 SMART
EGF 328 356 2.07e1 SMART
EGF_like 359 387 3.16e1 SMART
EGF_like 390 418 4.64e1 SMART
EGF_like 421 449 3.29e1 SMART
EGF_like 452 480 7.09e1 SMART
EGF 483 511 1.15e1 SMART
EGF 514 542 1.91e1 SMART
EGF_like 545 573 4.11e1 SMART
EGF 576 604 7.95e0 SMART
EGF 607 635 1.23e1 SMART
EGF_like 638 666 4.93e1 SMART
EGF_like 674 702 5.24e1 SMART
EGF 705 733 2.29e1 SMART
FN3 736 816 4.12e-3 SMART
FN3 827 904 1.21e-9 SMART
FN3 924 1003 3.97e-5 SMART
FN3 1019 1100 3.62e-8 SMART
low complexity region 1107 1118 N/A INTRINSIC
FN3 1119 1197 2.31e-6 SMART
FN3 1228 1308 8.77e-7 SMART
FN3 1337 1416 3.01e-5 SMART
FN3 1433 1513 2.76e-4 SMART
FN3 1534 1613 5.78e-7 SMART
FN3 1629 1709 4.7e-7 SMART
FN3 1728 1806 1.95e-4 SMART
FN3 1832 1911 4.56e-5 SMART
FN3 1943 2022 2.23e-8 SMART
FN3 2051 2130 5.61e-5 SMART
FN3 2146 2226 6.01e-5 SMART
FN3 2240 2319 6.45e-5 SMART
FN3 2334 2413 9.54e-8 SMART
FN3 2436 2516 2.81e-5 SMART
FN3 2536 2622 1.98e-5 SMART
FN3 2638 2716 5.65e-10 SMART
FN3 2727 2802 7.63e-7 SMART
FN3 2815 2890 6.54e-6 SMART
FBG 2907 3117 8.88e-125 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tenascin family of extracellular matrix glycoproteins. The tenascins have anti-adhesive effects, as opposed to fibronectin which is adhesive. This protein is thought to function in matrix maturation during wound healing, and its deficiency has been associated with the connective tissue disorder Ehlers-Danlos syndrome. This gene localizes to the major histocompatibility complex (MHC) class III region on chromosome 6. It is one of four genes in this cluster which have been duplicated. The duplicated copy of this gene is incomplete and is a pseudogene which is transcribed but does not encode a protein. The structure of this gene is unusual in that it overlaps the CREBL1 and CYP21A2 genes at its 5' and 3' ends, respectively. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice have stretchy skin, similar to patients with human Ehlers-Danlos syndrome. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 111 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610028H24Rik C A 10: 76,458,065 F252L possibly damaging Het
4921501E09Rik T C 17: 33,066,967 N287S probably benign Het
4930447A16Rik T G 15: 37,440,498 probably benign Het
Abca14 A T 7: 120,216,185 M219L probably benign Het
Abi3bp A G 16: 56,677,796 T918A probably damaging Het
Acss3 C T 10: 106,936,207 S669N probably benign Het
Adamts16 G A 13: 70,779,518 probably benign Het
Adamtsl4 A G 3: 95,681,102 Y559H probably damaging Het
Adgrg5 T A 8: 94,934,480 M106K probably damaging Het
Akt1 T C 12: 112,659,625 N71S probably damaging Het
Amer2 A C 14: 60,378,445 K30Q probably damaging Het
Anapc5 T C 5: 122,800,524 K383E probably damaging Het
Ano1 A G 7: 144,654,250 L258P probably damaging Het
Arhgef10l A G 4: 140,544,384 S560P probably damaging Het
Arhgef40 T A 14: 52,003,705 L1395Q probably damaging Het
Arid1a A T 4: 133,681,834 D1787E unknown Het
C77080 A G 4: 129,222,355 S884P probably damaging Het
Ces2h T C 8: 105,018,398 L388P probably damaging Het
Cfap54 T A 10: 93,016,604 N880I probably benign Het
Cryz T C 3: 154,621,683 V116A probably damaging Het
Csrp1 G A 1: 135,750,628 A159T probably damaging Het
Cttnbp2 A G 6: 18,434,518 F447S probably damaging Het
Cyp4a12a A T 4: 115,327,505 I328F probably damaging Het
Cyth4 T G 15: 78,608,171 H133Q probably damaging Het
Ddah2 A G 17: 35,060,426 I88V possibly damaging Het
Dmbt1 T G 7: 131,110,989 I1563S possibly damaging Het
Dnajc22 T C 15: 99,101,233 S100P probably benign Het
Fam172a A G 13: 77,999,637 T321A possibly damaging Het
Fancl T A 11: 26,422,459 D123E probably damaging Het
Fbxo30 A G 10: 11,291,028 Q498R probably damaging Het
Fgd4 T C 16: 16,435,960 H581R probably benign Het
Gm2663 T C 6: 40,997,966 Q57R probably benign Het
Gm5065 A G 7: 5,359,574 D68G probably benign Het
Gm7247 A T 14: 51,365,347 M47L possibly damaging Het
Gsdmc2 T A 15: 63,828,126 probably null Het
Hc A C 2: 35,013,528 F1038C probably damaging Het
Heatr1 C A 13: 12,414,478 Q890K possibly damaging Het
Hipk4 C A 7: 27,529,004 T293K probably damaging Het
Hp1bp3 C A 4: 138,221,632 A2E probably damaging Het
Il6 T C 5: 30,014,947 probably null Het
Itga6 A G 2: 71,818,484 D104G probably benign Het
Krt24 A G 11: 99,282,451 S293P probably damaging Het
Krt4 C T 15: 101,920,651 R309Q probably damaging Het
Krt40 A T 11: 99,540,087 W199R probably damaging Het
Lamc1 T C 1: 153,242,632 E931G probably benign Het
Lamp3 A T 16: 19,701,211 M74K probably benign Het
Magel2 G A 7: 62,379,096 V583I unknown Het
March7 T A 2: 60,229,040 Y37* probably null Het
Mrpl36 A G 13: 73,331,568 K66E probably damaging Het
Mrps35 G T 6: 147,061,484 E229* probably null Het
Mtmr6 T C 14: 60,298,992 M557T probably benign Het
Myocd A T 11: 65,187,028 I647N probably damaging Het
Myom2 A C 8: 15,131,151 L1350F probably damaging Het
Nosip T A 7: 45,076,609 S197T probably benign Het
Npat A G 9: 53,562,491 K528E probably benign Het
Nyap2 A G 1: 81,191,872 T115A probably benign Het
Olfr1032 A T 2: 86,008,223 Y149F probably damaging Het
Olfr1214 G T 2: 88,988,145 P19Q probably benign Het
Olfr122 A G 17: 37,772,576 R317G probably benign Het
Olfr1245 A G 2: 89,575,393 V111A probably damaging Het
Olfr65 T A 7: 103,907,042 V201D possibly damaging Het
Olfr972 A G 9: 39,874,058 Q261R probably benign Het
Orc1 T C 4: 108,590,700 V48A possibly damaging Het
Pde6d T C 1: 86,546,716 E69G probably damaging Het
Pdgfrb A T 18: 61,083,334 D1088V possibly damaging Het
Peg12 A G 7: 62,463,638 V237A probably benign Het
Piezo1 A G 8: 122,482,712 F2371L probably benign Het
Podn T A 4: 108,023,373 S27C probably damaging Het
Pom121l2 A G 13: 21,982,734 M392V possibly damaging Het
Ppm1b A G 17: 84,994,202 K170R probably damaging Het
Rab18 A T 18: 6,770,113 probably null Het
Raet1d G A 10: 22,371,012 A80T probably damaging Het
Rfx7 T A 9: 72,617,685 V719E probably benign Het
Rnf219 T A 14: 104,522,542 K24M probably damaging Het
Ror1 C T 4: 100,407,841 Q171* probably null Het
Rufy4 G A 1: 74,140,947 V454M possibly damaging Het
Ryr2 C T 13: 11,851,188 G292D possibly damaging Het
Ryr3 G T 2: 112,781,065 N2257K probably benign Het
Saal1 A G 7: 46,699,489 F306S possibly damaging Het
Sap18 A G 14: 57,798,564 N69S probably damaging Het
Sar1b A T 11: 51,779,687 probably null Het
Serpina3n G T 12: 104,409,214 V182L probably damaging Het
Setd3 A T 12: 108,118,254 H279Q probably damaging Het
Slc18a2 C A 19: 59,276,505 A307E possibly damaging Het
Slc4a10 A T 2: 62,234,381 D193V probably damaging Het
Spire2 T C 8: 123,332,918 C52R probably damaging Het
Syne2 A T 12: 76,074,579 I5940F probably damaging Het
Sytl1 C T 4: 133,256,160 S355N probably damaging Het
Tarbp1 C T 8: 126,428,114 V1424I probably damaging Het
Tatdn3 A T 1: 191,049,280 probably null Het
Tbpl1 T A 10: 22,707,677 E131D probably damaging Het
Telo2 A T 17: 25,105,408 M501K probably damaging Het
Terb1 A G 8: 104,452,699 V619A probably benign Het
Tmem132e A G 11: 82,445,163 T1024A probably benign Het
Tmem30a T C 9: 79,774,218 D223G probably damaging Het
Tmprss11d A G 5: 86,339,554 V19A probably damaging Het
Tnks A T 8: 34,851,106 S872T probably damaging Het
Tob2 T C 15: 81,851,199 K190E probably damaging Het
Togaram1 T C 12: 65,002,659 V1240A possibly damaging Het
Trim13 T A 14: 61,604,886 C117* probably null Het
Trpv4 G A 5: 114,634,605 R308C probably damaging Het
Ttn C G 2: 76,755,332 D21987H probably damaging Het
Ttn C A 2: 76,826,074 probably null Het
Upp1 A T 11: 9,133,240 M111L possibly damaging Het
Vmn1r206 A T 13: 22,620,188 V283E probably damaging Het
Vmn2r79 G T 7: 87,002,426 L344F probably benign Het
Vmn2r93 T G 17: 18,326,062 I732S probably damaging Het
Vmn2r96 G T 17: 18,584,001 M504I probably benign Het
Vps39 T C 2: 120,343,227 Y147C probably damaging Het
Zbtb20 T A 16: 43,577,652 C35S possibly damaging Het
Zfp871 A T 17: 32,774,777 C475S probably damaging Het
Other mutations in Tnxb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Tnxb APN 17 34685629 missense probably damaging 1.00
IGL00424:Tnxb APN 17 34714692 missense probably damaging 1.00
IGL00486:Tnxb APN 17 34692382 missense probably damaging 1.00
IGL00952:Tnxb APN 17 34713128 missense probably damaging 1.00
IGL00974:Tnxb APN 17 34718733 critical splice donor site probably null
IGL01017:Tnxb APN 17 34693808 missense probably damaging 0.98
IGL01082:Tnxb APN 17 34714610 missense probably damaging 0.97
IGL01397:Tnxb APN 17 34714673 missense probably damaging 0.99
IGL01473:Tnxb APN 17 34685701 missense probably damaging 0.99
IGL01642:Tnxb APN 17 34718514 missense probably damaging 1.00
IGL01774:Tnxb APN 17 34688839 missense probably damaging 1.00
IGL01971:Tnxb APN 17 34672297 missense probably damaging 1.00
IGL02016:Tnxb APN 17 34672275 missense probably damaging 0.98
IGL02160:Tnxb APN 17 34714745 missense probably benign 0.01
IGL02473:Tnxb APN 17 34717762 missense probably damaging 1.00
IGL02666:Tnxb APN 17 34684939 missense probably benign 0.20
IGL02831:Tnxb APN 17 34703571 missense possibly damaging 0.93
IGL02838:Tnxb APN 17 34689632 missense possibly damaging 0.74
IGL02965:Tnxb APN 17 34709654 missense possibly damaging 0.93
IGL03155:Tnxb APN 17 34713595 missense probably damaging 1.00
IGL03194:Tnxb APN 17 34695947 nonsense probably null
IGL03215:Tnxb APN 17 34692525 missense possibly damaging 0.66
IGL03256:Tnxb APN 17 34688720 missense probably damaging 1.00
E0370:Tnxb UTSW 17 34678943 missense probably damaging 1.00
R0006:Tnxb UTSW 17 34682292 missense probably benign 0.07
R0049:Tnxb UTSW 17 34709568 missense possibly damaging 0.93
R0050:Tnxb UTSW 17 34673325 missense probably damaging 1.00
R0233:Tnxb UTSW 17 34699033 missense probably benign 0.32
R0233:Tnxb UTSW 17 34699033 missense probably benign 0.32
R0311:Tnxb UTSW 17 34716984 missense probably damaging 0.97
R0326:Tnxb UTSW 17 34698179 missense probably benign 0.32
R0387:Tnxb UTSW 17 34683574 missense probably benign 0.30
R0396:Tnxb UTSW 17 34671733 missense probably damaging 1.00
R0511:Tnxb UTSW 17 34718245 missense probably damaging 0.96
R0540:Tnxb UTSW 17 34671918 missense probably damaging 1.00
R0563:Tnxb UTSW 17 34716947 missense probably benign 0.05
R0575:Tnxb UTSW 17 34717206 missense possibly damaging 0.91
R0586:Tnxb UTSW 17 34672144 missense probably damaging 1.00
R0607:Tnxb UTSW 17 34671918 missense probably damaging 1.00
R0622:Tnxb UTSW 17 34718729 missense probably damaging 1.00
R0624:Tnxb UTSW 17 34683548 missense probably damaging 1.00
R0709:Tnxb UTSW 17 34689354 missense probably damaging 1.00
R0898:Tnxb UTSW 17 34670745 missense probably damaging 1.00
R0970:Tnxb UTSW 17 34698943 missense possibly damaging 0.85
R0972:Tnxb UTSW 17 34685143 missense probably damaging 1.00
R1118:Tnxb UTSW 17 34685043 missense probably damaging 1.00
R1119:Tnxb UTSW 17 34685043 missense probably damaging 1.00
R1226:Tnxb UTSW 17 34688929 missense probably damaging 1.00
R1296:Tnxb UTSW 17 34671577 missense probably damaging 1.00
R1297:Tnxb UTSW 17 34710166 missense probably damaging 0.96
R1349:Tnxb UTSW 17 34710293 missense possibly damaging 0.67
R1356:Tnxb UTSW 17 34695472 missense possibly damaging 0.53
R1372:Tnxb UTSW 17 34710293 missense possibly damaging 0.67
R1521:Tnxb UTSW 17 34711503 missense probably damaging 1.00
R1522:Tnxb UTSW 17 34718638 missense probably damaging 1.00
R1532:Tnxb UTSW 17 34710830 missense probably damaging 1.00
R1735:Tnxb UTSW 17 34717970 missense probably damaging 1.00
R1778:Tnxb UTSW 17 34683574 missense probably benign 0.30
R1802:Tnxb UTSW 17 34703889 missense probably damaging 0.98
R1824:Tnxb UTSW 17 34692333 nonsense probably null
R1838:Tnxb UTSW 17 34678910 missense probably damaging 0.96
R1863:Tnxb UTSW 17 34670874 missense probably damaging 1.00
R1865:Tnxb UTSW 17 34703457 nonsense probably null
R1867:Tnxb UTSW 17 34671847 missense probably damaging 1.00
R1883:Tnxb UTSW 17 34689565 missense probably benign 0.01
R1884:Tnxb UTSW 17 34689565 missense probably benign 0.01
R1889:Tnxb UTSW 17 34695825 missense probably damaging 0.97
R1969:Tnxb UTSW 17 34679081 missense probably benign 0.20
R1989:Tnxb UTSW 17 34683377 missense probably benign 0.08
R1989:Tnxb UTSW 17 34693885 missense probably damaging 1.00
R1991:Tnxb UTSW 17 34671904 missense probably damaging 1.00
R1991:Tnxb UTSW 17 34682251 missense probably damaging 1.00
R1992:Tnxb UTSW 17 34671904 missense probably damaging 1.00
R2001:Tnxb UTSW 17 34692579 missense possibly damaging 0.82
R2030:Tnxb UTSW 17 34718469 missense probably damaging 1.00
R2037:Tnxb UTSW 17 34699205 missense probably damaging 1.00
R2103:Tnxb UTSW 17 34682251 missense probably damaging 1.00
R2116:Tnxb UTSW 17 34672227 missense probably damaging 1.00
R2206:Tnxb UTSW 17 34709417 missense possibly damaging 0.86
R2207:Tnxb UTSW 17 34709417 missense possibly damaging 0.86
R2215:Tnxb UTSW 17 34704140 missense possibly damaging 0.93
R2413:Tnxb UTSW 17 34718278 missense probably damaging 0.99
R2680:Tnxb UTSW 17 34703620 missense possibly damaging 0.51
R2910:Tnxb UTSW 17 34672450 missense probably damaging 1.00
R2984:Tnxb UTSW 17 34678662 nonsense probably null
R3120:Tnxb UTSW 17 34692355 missense possibly damaging 0.86
R3429:Tnxb UTSW 17 34672631 nonsense probably null
R3429:Tnxb UTSW 17 34703587 missense probably damaging 0.98
R3552:Tnxb UTSW 17 34718721 missense probably damaging 1.00
R3698:Tnxb UTSW 17 34690433 critical splice donor site probably null
R3720:Tnxb UTSW 17 34712964 missense possibly damaging 0.95
R3841:Tnxb UTSW 17 34698923 missense possibly damaging 0.72
R3848:Tnxb UTSW 17 34690395 missense possibly damaging 0.82
R3886:Tnxb UTSW 17 34718911 missense probably damaging 1.00
R4074:Tnxb UTSW 17 34671871 missense probably benign 0.22
R4159:Tnxb UTSW 17 34711517 missense probably damaging 0.99
R4160:Tnxb UTSW 17 34711517 missense probably damaging 0.99
R4161:Tnxb UTSW 17 34711517 missense probably damaging 0.99
R4181:Tnxb UTSW 17 34709454 missense possibly damaging 0.93
R4210:Tnxb UTSW 17 34710977 missense possibly damaging 0.84
R4275:Tnxb UTSW 17 34698231 missense probably damaging 0.98
R4329:Tnxb UTSW 17 34693864 missense probably damaging 1.00
R4394:Tnxb UTSW 17 34678662 nonsense probably null
R4395:Tnxb UTSW 17 34678662 nonsense probably null
R4397:Tnxb UTSW 17 34678662 nonsense probably null
R4540:Tnxb UTSW 17 34703335 missense possibly damaging 0.86
R4673:Tnxb UTSW 17 34672540 missense probably damaging 0.99
R4719:Tnxb UTSW 17 34689420 missense probably damaging 1.00
R4725:Tnxb UTSW 17 34699067 missense probably damaging 0.99
R4753:Tnxb UTSW 17 34695935 missense possibly damaging 0.71
R4777:Tnxb UTSW 17 34671943 missense probably damaging 1.00
R4837:Tnxb UTSW 17 34718007 missense probably damaging 0.98
R4898:Tnxb UTSW 17 34695592 missense possibly damaging 0.95
R4938:Tnxb UTSW 17 34713632 missense probably damaging 1.00
R5044:Tnxb UTSW 17 34717483 missense probably damaging 1.00
R5100:Tnxb UTSW 17 34710928 missense probably damaging 0.99
R5223:Tnxb UTSW 17 34704078 missense possibly damaging 0.51
R5269:Tnxb UTSW 17 34703608 missense possibly damaging 0.95
R5333:Tnxb UTSW 17 34690231 missense probably damaging 1.00
R5454:Tnxb UTSW 17 34709625 missense possibly damaging 0.71
R5470:Tnxb UTSW 17 34716973 missense probably null 1.00
R5475:Tnxb UTSW 17 34689593 missense probably damaging 1.00
R5574:Tnxb UTSW 17 34711024 missense probably benign
R5596:Tnxb UTSW 17 34688804 missense probably damaging 1.00
R5599:Tnxb UTSW 17 34690202 missense probably damaging 1.00
R5599:Tnxb UTSW 17 34690205 missense probably benign 0.22
R5615:Tnxb UTSW 17 34683418 missense probably damaging 1.00
R5620:Tnxb UTSW 17 34717530 nonsense probably null
R5625:Tnxb UTSW 17 34685211 missense probably benign 0.30
R5734:Tnxb UTSW 17 34698910 missense possibly damaging 0.53
R5896:Tnxb UTSW 17 34672152 missense probably damaging 1.00
R5961:Tnxb UTSW 17 34718635 missense probably damaging 1.00
R5974:Tnxb UTSW 17 34685707 missense probably damaging 1.00
R6091:Tnxb UTSW 17 34710364 missense probably damaging 0.98
R6134:Tnxb UTSW 17 34672012 missense probably damaging 0.96
R6325:Tnxb UTSW 17 34692424 missense probably damaging 1.00
R6358:Tnxb UTSW 17 34678994 missense probably damaging 0.98
R6362:Tnxb UTSW 17 34694388 missense probably damaging 1.00
R6432:Tnxb UTSW 17 34717917 missense probably damaging 1.00
R6461:Tnxb UTSW 17 34671898 missense probably damaging 1.00
R6467:Tnxb UTSW 17 34693924 missense probably damaging 1.00
R6476:Tnxb UTSW 17 34690192 missense probably damaging 0.98
R6477:Tnxb UTSW 17 34719539 missense probably damaging 1.00
R6631:Tnxb UTSW 17 34718248 missense probably damaging 1.00
R6774:Tnxb UTSW 17 34709632 nonsense probably null
R6787:Tnxb UTSW 17 34710736 missense probably benign 0.02
R6805:Tnxb UTSW 17 34698153 missense possibly damaging 0.93
R6860:Tnxb UTSW 17 34713157 missense probably damaging 0.99
R6883:Tnxb UTSW 17 34718519 missense probably damaging 1.00
R7049:Tnxb UTSW 17 34717268 critical splice donor site probably null
R7107:Tnxb UTSW 17 34671340 missense unknown
R7172:Tnxb UTSW 17 34696020 missense probably damaging 1.00
R7206:Tnxb UTSW 17 34704101 missense possibly damaging 0.71
R7219:Tnxb UTSW 17 34679065 missense probably benign 0.08
R7237:Tnxb UTSW 17 34682196 missense possibly damaging 0.82
R7257:Tnxb UTSW 17 34716501 missense probably benign 0.44
R7269:Tnxb UTSW 17 34695454 missense probably damaging 1.00
R7302:Tnxb UTSW 17 34678901 missense probably benign 0.41
X0004:Tnxb UTSW 17 34703415 missense possibly damaging 0.71
X0010:Tnxb UTSW 17 34671934 missense probably damaging 1.00
X0019:Tnxb UTSW 17 34694189 missense possibly damaging 0.51
X0063:Tnxb UTSW 17 34703508 missense probably damaging 0.98
X0064:Tnxb UTSW 17 34694032 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGCCCTGGAGATTGTCAGG -3'
(R):5'- CTACAGTCCGCTCCAGTATAC -3'

Sequencing Primer
(F):5'- CTACTCTGGCGAGGACTGTG -3'
(R):5'- TCCAGTATACCCGGGCCAG -3'
Posted On2014-08-25