Incidental Mutation 'R0142:Ipo13'
ID22361
Institutional Source Beutler Lab
Gene Symbol Ipo13
Ensembl Gene ENSMUSG00000033365
Gene Nameimportin 13
SynonymsKap13
MMRRC Submission 038427-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.956) question?
Stock #R0142 (G1)
Quality Score225
Status Validated (trace)
Chromosome4
Chromosomal Location117894486-117914999 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 117905569 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Arginine at position 279 (L279R)
Ref Sequence ENSEMBL: ENSMUSP00000035989 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036156]
Predicted Effect probably damaging
Transcript: ENSMUST00000036156
AA Change: L279R

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000035989
Gene: ENSMUSG00000033365
AA Change: L279R

DomainStartEndE-ValueType
low complexity region 9 18 N/A INTRINSIC
IBN_N 45 111 2.05e-7 SMART
Pfam:Xpo1 116 263 4.8e-29 PFAM
low complexity region 668 692 N/A INTRINSIC
low complexity region 767 779 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134752
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153918
Meta Mutation Damage Score 0.166 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.0%
  • 20x: 87.6%
Validation Efficiency 92% (61/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the importin-beta family of nuclear transport proteins. The encoded protein mediates the import of specific cargo proteins from the cytoplasm to the nucleus and is dependent on the Ras-related nuclear protein-GTPase system. The encoded protein is also involved in nuclear export of the eukaryotic translation initiation factor 1A.[provided by RefSeq, Mar 2009]
PHENOTYPE: Mice homozygous for a gene trap insertion die prior to genotyping age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik A G 19: 29,718,254 S1347P possibly damaging Het
Abca6 T G 11: 110,188,641 D1229A probably damaging Het
Abhd8 A C 8: 71,461,862 F41V probably damaging Het
Ago4 T G 4: 126,516,932 E222A probably benign Het
Ap3b2 T C 7: 81,473,080 I470V probably damaging Het
Bcl9l C T 9: 44,507,112 T749M probably benign Het
Bicc1 T C 10: 70,925,370 K937E probably damaging Het
Bmi1 G A 2: 18,683,284 probably null Het
Boc A C 16: 44,490,241 I772S probably damaging Het
C2 T A 17: 34,873,528 I178F possibly damaging Het
Cacna1c G T 6: 118,603,882 A1416E probably damaging Het
Chst10 A G 1: 38,871,729 L118P probably damaging Het
Crybg1 G A 10: 43,999,063 T683I possibly damaging Het
Cul5 C T 9: 53,635,050 V314I probably damaging Het
Dnajc17 C A 2: 119,179,934 R211I probably benign Het
Emilin1 A G 5: 30,913,920 T16A probably benign Het
Ercc6l2 A C 13: 63,872,506 probably benign Het
Fsd2 T A 7: 81,559,935 D53V probably damaging Het
Galnt13 A G 2: 55,098,603 D479G probably damaging Het
Grk3 A T 5: 112,915,053 W643R probably damaging Het
Hdgf G A 3: 87,913,109 A4T possibly damaging Het
Hnrnpr T A 4: 136,327,282 V182E probably damaging Het
Itga9 C A 9: 118,636,586 N169K probably damaging Het
Jph3 A G 8: 121,753,371 T263A possibly damaging Het
Jph4 G T 14: 55,108,326 Q625K probably benign Het
Kctd3 A C 1: 188,996,398 probably null Het
Kif26b A T 1: 178,915,389 S570C probably damaging Het
Klhl5 G A 5: 65,143,350 W164* probably null Het
Lacc1 A T 14: 77,030,799 H357Q probably benign Het
Lama2 A G 10: 27,187,845 I1316T probably benign Het
Lcp2 C T 11: 34,082,418 P332L probably damaging Het
Map3k6 A T 4: 133,250,946 H1033L probably benign Het
Mfsd2b A G 12: 4,866,234 V252A probably benign Het
Myo16 T A 8: 10,569,790 I1447N probably benign Het
Myo19 G A 11: 84,894,603 R224H probably damaging Het
Myo5a C T 9: 75,160,574 H637Y probably benign Het
Nek10 C T 14: 14,861,560 R539C possibly damaging Het
Nfix A T 8: 84,721,686 V404E probably damaging Het
Nr1i2 T C 16: 38,253,006 R203G probably benign Het
Nup210l G A 3: 90,172,113 G968D probably damaging Het
Olfr1494 A T 19: 13,749,255 I50F probably benign Het
Olfr697 G T 7: 106,741,765 H56Q probably benign Het
Olfr884 A T 9: 38,048,110 H296L probably benign Het
Phlpp2 C T 8: 109,907,513 R242W probably damaging Het
Plcz1 A G 6: 140,007,697 F398S probably damaging Het
Ppfibp2 C A 7: 107,744,177 P808T probably damaging Het
Srpk2 T C 5: 23,527,930 K239E probably damaging Het
Svep1 A G 4: 58,118,232 V830A probably benign Het
Tesc A T 5: 118,056,570 I149F possibly damaging Het
Thsd7a A G 6: 12,418,335 W632R probably damaging Het
Tmprss9 A G 10: 80,894,378 D704G possibly damaging Het
Tob1 T C 11: 94,214,597 Y320H probably damaging Het
Trpm3 G T 19: 22,987,916 D1582Y probably damaging Het
Ttc28 A G 5: 111,277,457 K1716R probably benign Het
Uqcrfs1 A G 13: 30,540,942 V205A probably benign Het
Usp29 G A 7: 6,962,335 M392I probably benign Het
Uspl1 A T 5: 149,188,349 Y22F possibly damaging Het
Virma C A 4: 11,548,783 N1780K probably benign Het
Vmn1r56 C T 7: 5,196,373 A82T probably benign Het
Vmn2r5 A T 3: 64,492,588 C553S probably damaging Het
Vwce A T 19: 10,664,612 R901W probably damaging Het
Wdpcp C A 11: 21,857,444 probably null Het
Zfp423 A T 8: 87,780,340 C1000* probably null Het
Zscan20 A G 4: 128,585,837 F954L probably benign Het
Other mutations in Ipo13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Ipo13 APN 4 117903405 missense probably benign 0.10
IGL00800:Ipo13 APN 4 117912308 missense probably benign 0.31
IGL00971:Ipo13 APN 4 117914367 missense possibly damaging 0.83
IGL01552:Ipo13 APN 4 117900964 missense probably benign 0.16
IGL01957:Ipo13 APN 4 117903881 missense probably damaging 0.99
IGL02262:Ipo13 APN 4 117903813 missense probably damaging 1.00
R0109:Ipo13 UTSW 4 117905016 missense possibly damaging 0.92
R0771:Ipo13 UTSW 4 117894646 missense possibly damaging 0.78
R1248:Ipo13 UTSW 4 117901031 missense probably damaging 1.00
R1381:Ipo13 UTSW 4 117904395 missense probably damaging 1.00
R1497:Ipo13 UTSW 4 117904659 missense probably benign 0.04
R1614:Ipo13 UTSW 4 117904618 missense probably benign 0.00
R1711:Ipo13 UTSW 4 117904522 missense probably benign 0.38
R2037:Ipo13 UTSW 4 117904661 nonsense probably null
R2200:Ipo13 UTSW 4 117904903 critical splice donor site probably null
R3698:Ipo13 UTSW 4 117900693 missense probably damaging 1.00
R3949:Ipo13 UTSW 4 117901042 missense probably benign 0.10
R4687:Ipo13 UTSW 4 117901576 missense probably benign 0.06
R4894:Ipo13 UTSW 4 117903441 missense probably damaging 0.99
R4894:Ipo13 UTSW 4 117904490 missense possibly damaging 0.84
R4956:Ipo13 UTSW 4 117901571 missense probably benign 0.00
R5679:Ipo13 UTSW 4 117894832 missense probably damaging 1.00
R5879:Ipo13 UTSW 4 117903203 missense possibly damaging 0.67
R5921:Ipo13 UTSW 4 117912089 missense probably benign 0.14
R6250:Ipo13 UTSW 4 117912154 missense possibly damaging 0.93
R6875:Ipo13 UTSW 4 117904911 missense possibly damaging 0.90
R7178:Ipo13 UTSW 4 117903884 missense possibly damaging 0.83
Z1088:Ipo13 UTSW 4 117904680 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- TACTTGGTCTAGCAAGGCCCTGTG -3'
(R):5'- TCAGCAGGAGCAGCATCAAAGC -3'

Sequencing Primer
(F):5'- TGAGGGTCCATAACTTGAACC -3'
(R):5'- ATCAAAGCAGCCTTGGTCTC -3'
Posted On2013-04-16