Incidental Mutation 'R2019:Itgax'
ID 223631
Institutional Source Beutler Lab
Gene Symbol Itgax
Ensembl Gene ENSMUSG00000030789
Gene Name integrin alpha X
Synonyms CD11C (p150) alpha polypeptide, CR4, Cd11c
MMRRC Submission 040028-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.079) question?
Stock # R2019 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 127728719-127749829 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 127747698 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Arginine at position 1038 (H1038R)
Ref Sequence ENSEMBL: ENSMUSP00000033053 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033053]
AlphaFold Q9QXH4
Predicted Effect probably benign
Transcript: ENSMUST00000033053
AA Change: H1038R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000033053
Gene: ENSMUSG00000030789
AA Change: H1038R

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Int_alpha 33 83 1.28e1 SMART
VWA 150 331 8.36e-43 SMART
Int_alpha 402 451 3.67e-3 SMART
Int_alpha 455 512 1.29e-7 SMART
Int_alpha 518 574 5.72e-14 SMART
Int_alpha 581 635 1.55e-1 SMART
transmembrane domain 1115 1137 N/A INTRINSIC
Pfam:Integrin_alpha 1138 1152 6.2e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206396
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the integrin alpha X chain protein. Integrins are heterodimeric integral membrane proteins composed of an alpha chain and a beta chain. This protein combines with the beta 2 chain (ITGB2) to form a leukocyte-specific integrin referred to as inactivated-C3b (iC3b) receptor 4 (CR4). The alpha X beta 2 complex seems to overlap the properties of the alpha M beta 2 integrin in the adherence of neutrophils and monocytes to stimulated endothelium cells, and in the phagocytosis of complement coated particles. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased susceptibility to bacterial infection, decreased susceptibility to experimental autoimmune encephalomyelitis (EAE), increased T cell proliferation, and an abnormal pattern of cytokine production during EAE. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610028H24Rik C A 10: 76,293,899 (GRCm39) F252L possibly damaging Het
Abcc9 G A 6: 142,621,160 (GRCm39) L527F probably damaging Het
Abi3bp A G 16: 56,498,159 (GRCm39) T918A probably damaging Het
Acp3 C T 9: 104,201,901 (GRCm39) G81R probably damaging Het
Acss3 C T 10: 106,772,068 (GRCm39) S669N probably benign Het
Akt1 T C 12: 112,626,059 (GRCm39) N71S probably damaging Het
Amz1 G T 5: 140,737,719 (GRCm39) M326I probably benign Het
Ankrd36 A G 11: 5,639,140 (GRCm39) I1351V probably benign Het
Art2b T C 7: 101,229,194 (GRCm39) D235G probably benign Het
Ccdc141 A C 2: 76,841,909 (GRCm39) I1507M probably damaging Het
Dck A G 5: 88,921,943 (GRCm39) Y135C probably damaging Het
Dmbt1 T G 7: 130,712,718 (GRCm39) I1563S possibly damaging Het
Dnttip2 T C 3: 122,074,393 (GRCm39) V610A possibly damaging Het
Efhb A G 17: 53,708,505 (GRCm39) S722P probably damaging Het
Emx2 A G 19: 59,447,771 (GRCm39) S42G probably benign Het
Ermard C T 17: 15,273,527 (GRCm39) R371C probably damaging Het
Fat1 T G 8: 45,476,783 (GRCm39) I1943S probably damaging Het
Fignl1 T C 11: 11,752,054 (GRCm39) K334E probably damaging Het
Fmn1 A C 2: 113,194,825 (GRCm39) K175T unknown Het
Gm7247 A T 14: 51,602,804 (GRCm39) M47L possibly damaging Het
Gpalpp1 A T 14: 76,348,131 (GRCm39) probably null Het
Hc A C 2: 34,903,540 (GRCm39) F1038C probably damaging Het
Ifngr1 A T 10: 19,467,861 (GRCm39) M10L probably damaging Het
Irx5 T G 8: 93,084,992 (GRCm39) Y61D probably damaging Het
Jag1 C T 2: 136,926,599 (GRCm39) E982K probably benign Het
Klhdc9 T C 1: 171,186,509 (GRCm39) D309G probably damaging Het
Lamp3 A T 16: 19,519,961 (GRCm39) M74K probably benign Het
Lrpprc A T 17: 85,059,759 (GRCm39) L685Q possibly damaging Het
Magel2 G A 7: 62,028,844 (GRCm39) V583I unknown Het
Mgat5b A G 11: 116,838,174 (GRCm39) Y271C probably benign Het
Mtmr6 T C 14: 60,536,441 (GRCm39) M557T probably benign Het
Myo16 T C 8: 10,426,260 (GRCm39) L339P probably benign Het
Neb G T 2: 52,122,288 (GRCm39) Y580* probably null Het
Npat A G 9: 53,473,791 (GRCm39) K528E probably benign Het
Or1j4 A T 2: 36,740,418 (GRCm39) Y120F possibly damaging Het
Or4a72 A G 2: 89,405,737 (GRCm39) V111A probably damaging Het
Or5m3 A T 2: 85,838,567 (GRCm39) Y149F probably damaging Het
Parp8 G A 13: 117,004,968 (GRCm39) probably benign Het
Phf3 G A 1: 30,850,928 (GRCm39) T1142M probably damaging Het
Phospho1 G A 11: 95,721,932 (GRCm39) V201M probably damaging Het
Piezo1 A G 8: 123,209,451 (GRCm39) F2371L probably benign Het
Pitpnm1 T C 19: 4,163,641 (GRCm39) S1209P probably damaging Het
Pkd1 T A 17: 24,787,658 (GRCm39) C20* probably null Het
Prdm5 C A 6: 65,808,340 (GRCm39) N95K probably damaging Het
Prkx T C X: 76,809,010 (GRCm39) D270G probably damaging Het
Ptgis A G 2: 167,050,199 (GRCm39) V310A probably damaging Het
Ptgis G A 2: 167,056,730 (GRCm39) Q286* probably null Het
Rpf1 T A 3: 146,226,976 (GRCm39) N59I probably damaging Het
Rpl3l A C 17: 24,954,490 (GRCm39) probably benign Het
Ryr2 C T 13: 11,866,074 (GRCm39) G292D possibly damaging Het
Ryr3 G T 2: 112,611,410 (GRCm39) N2257K probably benign Het
Sla T C 15: 66,654,404 (GRCm39) Y278C probably damaging Het
Slc4a10 A T 2: 62,064,725 (GRCm39) D193V probably damaging Het
Spire2 T C 8: 124,059,657 (GRCm39) C52R probably damaging Het
Tada2b T C 5: 36,641,250 (GRCm39) Y51C probably damaging Het
Tarbp1 C T 8: 127,154,853 (GRCm39) V1424I probably damaging Het
Tbpl1 T A 10: 22,583,576 (GRCm39) E131D probably damaging Het
Tgfbrap1 A G 1: 43,093,677 (GRCm39) probably null Het
Tmem116 A G 5: 121,627,317 (GRCm39) I151M possibly damaging Het
Tmem30a T C 9: 79,681,500 (GRCm39) D223G probably damaging Het
Trim13 T A 14: 61,842,335 (GRCm39) C117* probably null Het
Ttn C G 2: 76,585,676 (GRCm39) D21987H probably damaging Het
Txnrd1 G A 10: 82,713,207 (GRCm39) V90I probably benign Het
Unc79 G A 12: 103,137,830 (GRCm39) probably null Het
Upp1 A T 11: 9,083,240 (GRCm39) M111L possibly damaging Het
Vmn2r79 G T 7: 86,651,634 (GRCm39) L344F probably benign Het
Vps39 T C 2: 120,173,708 (GRCm39) Y147C probably damaging Het
Wdr59 A G 8: 112,193,425 (GRCm39) Y666H probably damaging Het
Wdr95 A G 5: 149,497,613 (GRCm39) probably benign Het
Other mutations in Itgax
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Itgax APN 7 127,734,498 (GRCm39) missense probably damaging 1.00
IGL00325:Itgax APN 7 127,747,481 (GRCm39) missense possibly damaging 0.69
IGL01155:Itgax APN 7 127,744,207 (GRCm39) missense probably benign 0.00
IGL01461:Itgax APN 7 127,734,190 (GRCm39) missense probably damaging 1.00
IGL01508:Itgax APN 7 127,743,990 (GRCm39) missense probably damaging 1.00
IGL01549:Itgax APN 7 127,730,378 (GRCm39) splice site probably null
IGL01864:Itgax APN 7 127,732,935 (GRCm39) missense probably benign 0.00
IGL02094:Itgax APN 7 127,730,645 (GRCm39) missense probably damaging 1.00
IGL02364:Itgax APN 7 127,739,154 (GRCm39) missense possibly damaging 0.89
IGL02969:Itgax APN 7 127,748,295 (GRCm39) missense probably benign
IGL03406:Itgax APN 7 127,748,370 (GRCm39) missense possibly damaging 0.93
Adendritic UTSW 7 127,747,744 (GRCm39) nonsense probably null
PIT4651001:Itgax UTSW 7 127,748,282 (GRCm39) missense probably benign 0.11
R0366:Itgax UTSW 7 127,748,261 (GRCm39) splice site probably benign
R0763:Itgax UTSW 7 127,747,112 (GRCm39) splice site probably benign
R1072:Itgax UTSW 7 127,749,316 (GRCm39) missense probably damaging 0.96
R1659:Itgax UTSW 7 127,730,063 (GRCm39) missense probably benign 0.15
R2418:Itgax UTSW 7 127,741,505 (GRCm39) missense probably damaging 0.98
R3027:Itgax UTSW 7 127,747,744 (GRCm39) nonsense probably null
R3846:Itgax UTSW 7 127,732,939 (GRCm39) missense probably damaging 1.00
R3938:Itgax UTSW 7 127,735,445 (GRCm39) missense possibly damaging 0.73
R4021:Itgax UTSW 7 127,732,311 (GRCm39) critical splice donor site probably null
R4027:Itgax UTSW 7 127,740,438 (GRCm39) missense possibly damaging 0.75
R4163:Itgax UTSW 7 127,743,872 (GRCm39) missense probably benign 0.00
R4923:Itgax UTSW 7 127,747,700 (GRCm39) missense probably benign
R5259:Itgax UTSW 7 127,747,450 (GRCm39) missense probably damaging 0.99
R5333:Itgax UTSW 7 127,741,455 (GRCm39) missense probably damaging 1.00
R5347:Itgax UTSW 7 127,740,474 (GRCm39) missense probably benign 0.08
R5679:Itgax UTSW 7 127,734,162 (GRCm39) missense probably benign 0.00
R5725:Itgax UTSW 7 127,747,033 (GRCm39) missense possibly damaging 0.63
R5733:Itgax UTSW 7 127,739,647 (GRCm39) missense probably damaging 0.99
R5750:Itgax UTSW 7 127,743,878 (GRCm39) missense probably benign 0.32
R5964:Itgax UTSW 7 127,739,619 (GRCm39) missense probably damaging 1.00
R6004:Itgax UTSW 7 127,730,624 (GRCm39) missense probably damaging 0.96
R6168:Itgax UTSW 7 127,732,269 (GRCm39) missense probably damaging 0.99
R6212:Itgax UTSW 7 127,747,025 (GRCm39) missense probably benign 0.16
R6212:Itgax UTSW 7 127,729,504 (GRCm39) missense possibly damaging 0.52
R6480:Itgax UTSW 7 127,747,771 (GRCm39) missense probably benign 0.12
R6484:Itgax UTSW 7 127,732,890 (GRCm39) missense probably benign 0.13
R6796:Itgax UTSW 7 127,734,236 (GRCm39) missense probably damaging 1.00
R6844:Itgax UTSW 7 127,747,106 (GRCm39) splice site probably null
R7287:Itgax UTSW 7 127,747,677 (GRCm39) missense probably damaging 1.00
R7365:Itgax UTSW 7 127,734,481 (GRCm39) missense probably damaging 1.00
R7421:Itgax UTSW 7 127,739,604 (GRCm39) missense probably damaging 1.00
R7599:Itgax UTSW 7 127,747,262 (GRCm39) missense probably damaging 0.99
R7710:Itgax UTSW 7 127,735,028 (GRCm39) missense probably benign 0.04
R7964:Itgax UTSW 7 127,739,590 (GRCm39) critical splice acceptor site probably null
R8220:Itgax UTSW 7 127,730,090 (GRCm39) missense probably benign 0.00
R8730:Itgax UTSW 7 127,739,066 (GRCm39) critical splice acceptor site probably null
R8742:Itgax UTSW 7 127,743,795 (GRCm39) missense probably benign 0.28
R8812:Itgax UTSW 7 127,732,979 (GRCm39) missense probably damaging 1.00
R8871:Itgax UTSW 7 127,735,223 (GRCm39) missense probably damaging 1.00
R9147:Itgax UTSW 7 127,747,913 (GRCm39) missense possibly damaging 0.74
R9149:Itgax UTSW 7 127,730,641 (GRCm39) missense probably benign 0.01
R9310:Itgax UTSW 7 127,741,432 (GRCm39) nonsense probably null
R9376:Itgax UTSW 7 127,747,935 (GRCm39) missense possibly damaging 0.94
R9377:Itgax UTSW 7 127,732,849 (GRCm39) missense probably benign 0.03
R9641:Itgax UTSW 7 127,741,152 (GRCm39) missense probably damaging 1.00
R9650:Itgax UTSW 7 127,734,935 (GRCm39) missense probably benign 0.24
R9709:Itgax UTSW 7 127,735,500 (GRCm39) missense probably damaging 1.00
X0061:Itgax UTSW 7 127,728,779 (GRCm39) start gained probably benign
Z1176:Itgax UTSW 7 127,744,044 (GRCm39) missense probably benign 0.24
Z1177:Itgax UTSW 7 127,747,234 (GRCm39) missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- AAAAGAGTCCCGTGCTGGTG -3'
(R):5'- GTTCAAAGACTGCCCTGACC -3'

Sequencing Primer
(F):5'- TCCCGTGCTGGTGAGGAAAAC -3'
(R):5'- ACTGCCCTGACCCAAGGATG -3'
Posted On 2014-08-25