Incidental Mutation 'R2019:2610028H24Rik'
List |< first << previous [record 93 of 18487] next >> last >|
ID223659
Institutional Source Beutler Lab
Gene Symbol 2610028H24Rik
Ensembl Gene ENSMUSG00000009114
Gene NameRIKEN cDNA 2610028H24 gene
SynonymsORF67
MMRRC Submission 040028-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.112) question?
Stock #R2019 (G1)
Quality Score168
Status Validated
Chromosome10
Chromosomal Location76449081-76461110 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 76458065 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 252 (F252L)
Ref Sequence ENSEMBL: ENSMUSP00000090061 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049185] [ENSMUST00000092406] [ENSMUST00000105415]
Predicted Effect probably benign
Transcript: ENSMUST00000049185
SMART Domains Protein: ENSMUSP00000045647
Gene: ENSMUSG00000033126

DomainStartEndE-ValueType
Pfam:UPF0054 8 148 7.6e-29 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000092406
AA Change: F252L

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000090061
Gene: ENSMUSG00000009114
AA Change: F252L

DomainStartEndE-ValueType
low complexity region 13 27 N/A INTRINSIC
low complexity region 94 140 N/A INTRINSIC
Pfam:DUF4587 145 216 7.6e-33 PFAM
low complexity region 223 235 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105415
AA Change: F231L

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000101055
Gene: ENSMUSG00000009114
AA Change: F231L

DomainStartEndE-ValueType
low complexity region 73 119 N/A INTRINSIC
Pfam:DUF4587 124 195 4.4e-34 PFAM
low complexity region 202 214 N/A INTRINSIC
Meta Mutation Damage Score 0.0604 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency 100% (71/71)
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 G A 6: 142,675,434 L527F probably damaging Het
Abi3bp A G 16: 56,677,796 T918A probably damaging Het
Acpp C T 9: 104,324,702 G81R probably damaging Het
Acss3 C T 10: 106,936,207 S669N probably benign Het
Akt1 T C 12: 112,659,625 N71S probably damaging Het
Amz1 G T 5: 140,751,964 M326I probably benign Het
Ankrd36 A G 11: 5,689,140 I1351V probably benign Het
Art2b T C 7: 101,579,987 D235G probably benign Het
Ccdc141 A C 2: 77,011,565 I1507M probably damaging Het
Dck A G 5: 88,774,084 Y135C probably damaging Het
Dmbt1 T G 7: 131,110,989 I1563S possibly damaging Het
Dnttip2 T C 3: 122,280,744 V610A possibly damaging Het
Efhb A G 17: 53,401,477 S722P probably damaging Het
Emx2 A G 19: 59,459,339 S42G probably benign Het
Ermard C T 17: 15,053,265 R371C probably damaging Het
Fat1 T G 8: 45,023,746 I1943S probably damaging Het
Fignl1 T C 11: 11,802,054 K334E probably damaging Het
Fmn1 A C 2: 113,364,480 K175T unknown Het
Gm7247 A T 14: 51,365,347 M47L possibly damaging Het
Gpalpp1 A T 14: 76,110,691 probably null Het
Hc A C 2: 35,013,528 F1038C probably damaging Het
Ifngr1 A T 10: 19,592,113 M10L probably damaging Het
Irx5 T G 8: 92,358,364 Y61D probably damaging Het
Itgax A G 7: 128,148,526 H1038R probably benign Het
Jag1 C T 2: 137,084,679 E982K probably benign Het
Klhdc9 T C 1: 171,358,941 D309G probably damaging Het
Lamp3 A T 16: 19,701,211 M74K probably benign Het
Lrpprc A T 17: 84,752,331 L685Q possibly damaging Het
Magel2 G A 7: 62,379,096 V583I unknown Het
Mgat5b A G 11: 116,947,348 Y271C probably benign Het
Mtmr6 T C 14: 60,298,992 M557T probably benign Het
Myo16 T C 8: 10,376,260 L339P probably benign Het
Neb G T 2: 52,232,276 Y580* probably null Het
Npat A G 9: 53,562,491 K528E probably benign Het
Olfr1032 A T 2: 86,008,223 Y149F probably damaging Het
Olfr1245 A G 2: 89,575,393 V111A probably damaging Het
Olfr350 A T 2: 36,850,406 Y120F possibly damaging Het
Parp8 G A 13: 116,868,432 probably benign Het
Phf3 G A 1: 30,811,847 T1142M probably damaging Het
Phospho1 G A 11: 95,831,106 V201M probably damaging Het
Piezo1 A G 8: 122,482,712 F2371L probably benign Het
Pitpnm1 T C 19: 4,113,641 S1209P probably damaging Het
Pkd1 T A 17: 24,568,684 C20* probably null Het
Prdm5 C A 6: 65,831,356 N95K probably damaging Het
Prkx T C X: 77,765,404 D270G probably damaging Het
Ptgis A G 2: 167,208,279 V310A probably damaging Het
Ptgis G A 2: 167,214,810 Q286* probably null Het
Rpf1 T A 3: 146,521,221 N59I probably damaging Het
Rpl3l A C 17: 24,735,516 probably benign Het
Ryr2 C T 13: 11,851,188 G292D possibly damaging Het
Ryr3 G T 2: 112,781,065 N2257K probably benign Het
Sla T C 15: 66,782,555 Y278C probably damaging Het
Slc4a10 A T 2: 62,234,381 D193V probably damaging Het
Spire2 T C 8: 123,332,918 C52R probably damaging Het
Tada2b T C 5: 36,483,906 Y51C probably damaging Het
Tarbp1 C T 8: 126,428,114 V1424I probably damaging Het
Tbpl1 T A 10: 22,707,677 E131D probably damaging Het
Tgfbrap1 A G 1: 43,054,517 probably null Het
Tmem116 A G 5: 121,489,254 I151M possibly damaging Het
Tmem30a T C 9: 79,774,218 D223G probably damaging Het
Trim13 T A 14: 61,604,886 C117* probably null Het
Ttn C G 2: 76,755,332 D21987H probably damaging Het
Txnrd1 G A 10: 82,877,373 V90I probably benign Het
Unc79 G A 12: 103,171,571 probably null Het
Upp1 A T 11: 9,133,240 M111L possibly damaging Het
Vmn2r79 G T 7: 87,002,426 L344F probably benign Het
Vps39 T C 2: 120,343,227 Y147C probably damaging Het
Wdr59 A G 8: 111,466,793 Y666H probably damaging Het
Wdr95 A G 5: 149,574,148 probably benign Het
Other mutations in 2610028H24Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02400:2610028H24Rik APN 10 76454810 missense possibly damaging 0.75
IGL02951:2610028H24Rik APN 10 76454702 splice site probably benign
R0013:2610028H24Rik UTSW 10 76457512 missense probably benign 0.32
R0295:2610028H24Rik UTSW 10 76454808 missense probably damaging 0.99
R2018:2610028H24Rik UTSW 10 76458065 missense possibly damaging 0.85
R2128:2610028H24Rik UTSW 10 76457515 missense possibly damaging 0.93
R2129:2610028H24Rik UTSW 10 76457515 missense possibly damaging 0.93
R4776:2610028H24Rik UTSW 10 76457512 missense probably benign 0.16
R5638:2610028H24Rik UTSW 10 76452895 missense probably benign 0.17
R5808:2610028H24Rik UTSW 10 76450648 missense probably damaging 1.00
R5896:2610028H24Rik UTSW 10 76452830 missense probably benign 0.01
R5990:2610028H24Rik UTSW 10 76449289 missense probably benign 0.08
R6238:2610028H24Rik UTSW 10 76449262 missense possibly damaging 0.86
R6505:2610028H24Rik UTSW 10 76449281 missense probably benign 0.02
X0026:2610028H24Rik UTSW 10 76458091 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- GAAAGGATGTTGAAGTCCTGGTC -3'
(R):5'- ATAGCCACAGTACATGGGCC -3'

Sequencing Primer
(F):5'- TCTGCCAGGACCAACGATG -3'
(R):5'- CTGACCACAGAGTGCATGCATG -3'
Posted On2014-08-25