Incidental Mutation 'R1992:Tnxb'
ID223756
Institutional Source Beutler Lab
Gene Symbol Tnxb
Ensembl Gene ENSMUSG00000033327
Gene Nametenascin XB
SynonymsTnx, TN-MHC
MMRRC Submission 040003-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1992 (G1)
Quality Score204
Status Not validated
Chromosome17
Chromosomal Location34670535-34719815 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 34671904 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 407 (V407A)
Ref Sequence ENSEMBL: ENSMUSP00000084661 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087399] [ENSMUST00000168533]
Predicted Effect probably damaging
Transcript: ENSMUST00000087399
AA Change: V407A

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000084661
Gene: ENSMUSG00000033327
AA Change: V407A

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 33 44 N/A INTRINSIC
low complexity region 69 89 N/A INTRINSIC
low complexity region 92 103 N/A INTRINSIC
EGF 173 201 1.59e1 SMART
EGF 204 232 7.41e0 SMART
EGF 235 263 2.64e1 SMART
EGF 266 294 2.64e1 SMART
EGF 297 325 9.13e0 SMART
EGF 328 356 2.07e1 SMART
EGF_like 359 387 3.16e1 SMART
EGF_like 390 418 4.64e1 SMART
EGF_like 421 449 3.29e1 SMART
EGF_like 452 480 7.09e1 SMART
EGF 483 511 1.15e1 SMART
EGF 514 542 1.91e1 SMART
EGF_like 545 573 4.11e1 SMART
EGF 576 604 7.95e0 SMART
EGF 607 635 1.23e1 SMART
EGF_like 638 666 4.93e1 SMART
EGF_like 674 702 5.24e1 SMART
EGF 705 733 2.29e1 SMART
FN3 736 816 4.12e-3 SMART
FN3 827 904 1.21e-9 SMART
FN3 1047 1126 3.97e-5 SMART
FN3 1142 1223 3.62e-8 SMART
low complexity region 1230 1241 N/A INTRINSIC
FN3 1242 1320 2.31e-6 SMART
FN3 1351 1431 8.77e-7 SMART
FN3 1460 1539 3.01e-5 SMART
FN3 1556 1636 2.76e-4 SMART
FN3 1657 1736 5.78e-7 SMART
FN3 1752 1832 4.7e-7 SMART
FN3 1851 1929 1.95e-4 SMART
FN3 1955 2034 4.56e-5 SMART
FN3 2066 2145 2.23e-8 SMART
FN3 2164 2244 7.75e-8 SMART
FN3 2279 2358 8.5e-5 SMART
FN3 2387 2467 2.94e-8 SMART
FN3 2501 2580 1.7e-4 SMART
low complexity region 2588 2598 N/A INTRINSIC
FN3 2607 2687 6.75e-8 SMART
FN3 2716 2795 7.4e-5 SMART
FN3 2822 2902 1.35e-7 SMART
FN3 2931 3010 5.61e-5 SMART
FN3 3026 3106 6.01e-5 SMART
FN3 3120 3199 6.45e-5 SMART
FN3 3214 3293 9.54e-8 SMART
FN3 3316 3396 2.81e-5 SMART
FN3 3416 3502 1.98e-5 SMART
FN3 3518 3596 5.65e-10 SMART
FN3 3607 3682 7.63e-7 SMART
FN3 3695 3770 6.54e-6 SMART
FBG 3787 3997 8.88e-125 SMART
Predicted Effect unknown
Transcript: ENSMUST00000168533
AA Change: V407A
SMART Domains Protein: ENSMUSP00000127487
Gene: ENSMUSG00000033327
AA Change: V407A

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 33 44 N/A INTRINSIC
low complexity region 69 89 N/A INTRINSIC
low complexity region 92 103 N/A INTRINSIC
EGF 173 201 1.59e1 SMART
EGF 204 232 7.41e0 SMART
EGF 235 263 2.64e1 SMART
EGF 266 294 2.64e1 SMART
EGF 297 325 9.13e0 SMART
EGF 328 356 2.07e1 SMART
EGF_like 359 387 3.16e1 SMART
EGF_like 390 418 4.64e1 SMART
EGF_like 421 449 3.29e1 SMART
EGF_like 452 480 7.09e1 SMART
EGF 483 511 1.15e1 SMART
EGF 514 542 1.91e1 SMART
EGF_like 545 573 4.11e1 SMART
EGF 576 604 7.95e0 SMART
EGF 607 635 1.23e1 SMART
EGF_like 638 666 4.93e1 SMART
EGF_like 674 702 5.24e1 SMART
EGF 705 733 2.29e1 SMART
FN3 736 816 4.12e-3 SMART
FN3 827 904 1.21e-9 SMART
FN3 924 1003 3.97e-5 SMART
FN3 1019 1100 3.62e-8 SMART
low complexity region 1107 1118 N/A INTRINSIC
FN3 1119 1197 2.31e-6 SMART
FN3 1228 1308 8.77e-7 SMART
FN3 1337 1416 3.01e-5 SMART
FN3 1433 1513 2.76e-4 SMART
FN3 1534 1613 5.78e-7 SMART
FN3 1629 1709 4.7e-7 SMART
FN3 1728 1806 1.95e-4 SMART
FN3 1832 1911 4.56e-5 SMART
FN3 1943 2022 2.23e-8 SMART
FN3 2051 2130 5.61e-5 SMART
FN3 2146 2226 6.01e-5 SMART
FN3 2240 2319 6.45e-5 SMART
FN3 2334 2413 9.54e-8 SMART
FN3 2436 2516 2.81e-5 SMART
FN3 2536 2622 1.98e-5 SMART
FN3 2638 2716 5.65e-10 SMART
FN3 2727 2802 7.63e-7 SMART
FN3 2815 2890 6.54e-6 SMART
FBG 2907 3117 8.88e-125 SMART
Meta Mutation Damage Score 0.064 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tenascin family of extracellular matrix glycoproteins. The tenascins have anti-adhesive effects, as opposed to fibronectin which is adhesive. This protein is thought to function in matrix maturation during wound healing, and its deficiency has been associated with the connective tissue disorder Ehlers-Danlos syndrome. This gene localizes to the major histocompatibility complex (MHC) class III region on chromosome 6. It is one of four genes in this cluster which have been duplicated. The duplicated copy of this gene is incomplete and is a pseudogene which is transcribed but does not encode a protein. The structure of this gene is unusual in that it overlaps the CREBL1 and CYP21A2 genes at its 5' and 3' ends, respectively. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice have stretchy skin, similar to patients with human Ehlers-Danlos syndrome. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 123 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008L16Rik A G 12: 55,338,206 D89G probably damaging Het
1600015I10Rik T A 6: 48,930,769 H234Q probably damaging Het
2310009B15Rik T C 1: 138,853,642 T90A probably damaging Het
4430402I18Rik A G 19: 28,948,624 F130L probably damaging Het
4932438A13Rik A T 3: 37,000,032 H3100L probably benign Het
A930011G23Rik T C 5: 99,233,925 D326G possibly damaging Het
Abcc2 A T 19: 43,807,142 I446F probably damaging Het
Adamts14 A G 10: 61,198,660 Y1150H probably benign Het
Adgrl2 A G 3: 148,817,244 I217T possibly damaging Het
Afap1l1 A T 18: 61,741,771 Y446* probably null Het
Aimp2 G A 5: 143,906,730 A14V probably damaging Het
Akap8 G A 17: 32,316,612 H143Y probably damaging Het
Aldh2 A T 5: 121,575,963 V207E possibly damaging Het
Armc3 T C 2: 19,293,142 Y575H probably damaging Het
Arpp21 T C 9: 112,157,793 E230G probably damaging Het
Arrdc3 G A 13: 80,883,689 D14N probably damaging Het
Atn1 A G 6: 124,745,328 probably benign Het
Atxn7l1 G A 12: 33,358,744 D302N probably damaging Het
Bbs1 T A 19: 4,891,708 H518L probably benign Het
Bmpr1a C A 14: 34,425,093 G241C probably damaging Het
Cacna1b G A 2: 24,732,306 P222L probably damaging Het
Calcrl T C 2: 84,370,511 Y63C probably damaging Het
Cand2 A G 6: 115,785,132 H173R possibly damaging Het
Cap2 T A 13: 46,637,881 Y175N possibly damaging Het
Card14 A T 11: 119,321,821 probably null Het
Cd3d T A 9: 44,985,001 Y29* probably null Het
Cd4 A G 6: 124,867,688 V378A possibly damaging Het
Cluh A T 11: 74,660,002 H318L probably damaging Het
Clvs1 T A 4: 9,281,899 D114E probably benign Het
Cnot4 T A 6: 35,023,409 T548S probably benign Het
Col18a1 T C 10: 77,081,154 I114V unknown Het
Cr2 G A 1: 195,154,150 P1278S possibly damaging Het
Crebbp A T 16: 4,128,697 probably null Het
D430042O09Rik A G 7: 125,820,089 N476S probably benign Het
Dnah7a T G 1: 53,582,676 K1097Q possibly damaging Het
Doc2a T A 7: 126,851,807 probably null Het
Dpp10 A T 1: 123,905,106 V48E probably null Het
Dsg2 A G 18: 20,601,473 K836R probably damaging Het
Egr2 T C 10: 67,540,027 V164A probably damaging Het
Erbin A T 13: 103,833,713 S1132T probably benign Het
Espn T A 4: 152,128,555 probably null Het
Fam83b A G 9: 76,492,022 S600P probably benign Het
Fanca A T 8: 123,297,812 N425K possibly damaging Het
Flot2 C T 11: 78,058,619 L294F probably damaging Het
Frs2 A G 10: 117,074,554 V301A probably benign Het
Fv1 T A 4: 147,869,161 N61K possibly damaging Het
Fxr2 A G 11: 69,649,833 E339G possibly damaging Het
Gck T C 11: 5,906,515 Y214C probably damaging Het
Gm4858 G T 3: 93,074,037 A121S probably benign Het
Gm5346 T C 8: 43,627,139 K16R probably benign Het
Gm9573 A T 17: 35,618,708 S1529T probably benign Het
Golga3 C G 5: 110,192,973 T551R probably damaging Het
Gorab A G 1: 163,397,056 S59P probably damaging Het
Gsdme C T 6: 50,208,122 V451M probably damaging Het
H2-Bl A C 17: 36,081,046 I216S probably damaging Het
Herc4 T A 10: 63,245,964 V22E possibly damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Hoxa2 A T 6: 52,164,596 S17T probably damaging Het
Hs3st5 A G 10: 36,832,886 Y139C probably damaging Het
Ism1 G A 2: 139,746,017 V221I probably benign Het
Kalrn T G 16: 33,975,738 L1222F probably damaging Het
Kdm4c A G 4: 74,343,394 D602G possibly damaging Het
Ktn1 A G 14: 47,695,521 K711E probably damaging Het
Lce1k A T 3: 92,806,818 C20S unknown Het
Macf1 A G 4: 123,456,695 S3792P probably damaging Het
Maml3 C T 3: 51,690,757 M189I probably benign Het
Mcc C A 18: 44,491,315 E213* probably null Het
Mep1a T G 17: 43,502,682 I13L probably benign Het
Mkrn2 G T 6: 115,609,601 C16F probably damaging Het
Mlh1 C T 9: 111,228,563 A727T probably damaging Het
Naa16 T C 14: 79,356,491 Y344C probably damaging Het
Nebl T A 2: 17,452,510 I80F probably damaging Het
Nlrc4 T A 17: 74,445,633 Y585F probably benign Het
Nrcam A G 12: 44,540,970 K149R probably damaging Het
Nufip1 T A 14: 76,134,847 I467N probably damaging Het
Nup133 A G 8: 123,906,221 I1057T possibly damaging Het
Obscn A T 11: 58,995,827 probably benign Het
Olfr1113 T A 2: 87,213,244 C117* probably null Het
Olfr173 A G 16: 58,796,946 V300A probably benign Het
Olfr177 A C 16: 58,872,511 I213R probably benign Het
Pi4k2a A T 19: 42,115,938 I380F probably damaging Het
Piezo2 A T 18: 63,074,662 L1426Q probably null Het
Pik3cg A T 12: 32,204,025 D654E possibly damaging Het
Poli G T 18: 70,508,987 P714Q probably damaging Het
Polr3f A G 2: 144,536,310 N201D probably benign Het
Ptprz1 A T 6: 22,959,748 K81N probably benign Het
Rbm19 T C 5: 120,133,883 probably null Het
Sec24a C T 11: 51,736,363 V241I probably benign Het
Sgk3 A G 1: 9,880,342 T160A possibly damaging Het
Slc1a4 A G 11: 20,304,375 I497T probably benign Het
Slc26a9 A T 1: 131,762,794 D512V probably damaging Het
Slc43a3 C T 2: 84,957,740 R489C probably damaging Het
Slc5a12 T A 2: 110,621,744 F327L probably benign Het
Slitrk3 A G 3: 73,049,771 V556A possibly damaging Het
Spib T C 7: 44,528,857 E180G probably benign Het
Spint2 T A 7: 29,259,408 N128Y probably damaging Het
Spx G A 6: 142,418,519 G102E probably benign Het
Spz1 T A 13: 92,575,658 E103D possibly damaging Het
Sstr2 T C 11: 113,624,669 I138T probably benign Het
Sytl3 T A 17: 6,733,049 I206N possibly damaging Het
Tcaf2 T C 6: 42,629,857 T388A probably benign Het
Thap12 T C 7: 98,716,365 V580A possibly damaging Het
Tlr5 T A 1: 182,974,347 D405E probably damaging Het
Tpx2 T A 2: 152,890,624 M606K probably benign Het
Trim43a T G 9: 88,584,259 L211R probably damaging Het
Trim46 A T 3: 89,237,701 Y489N probably damaging Het
Ttc28 C T 5: 111,276,322 S1485L probably benign Het
Ttll8 T C 15: 88,914,451 T694A probably benign Het
Txnl1 T C 18: 63,679,514 T70A probably benign Het
Ube3a C T 7: 59,303,787 A823V probably damaging Het
Ubqln5 C A 7: 104,129,534 V28F probably damaging Het
Ulk1 T A 5: 110,787,151 Q972L probably damaging Het
Unc93b1 T C 19: 3,944,062 Y398H probably benign Het
Usp1 A G 4: 98,934,294 D615G probably benign Het
Utp15 A G 13: 98,250,912 C385R probably benign Het
Vmn2r91 T A 17: 18,135,880 V603D probably damaging Het
Whamm C T 7: 81,591,771 R277* probably null Het
Wnt8a A G 18: 34,544,884 D115G probably damaging Het
Yjefn3 A T 8: 69,888,995 probably null Het
Ywhab A T 2: 164,011,887 I95F probably damaging Het
Zfp143 C T 7: 110,061,282 probably benign Het
Zfp607b C G 7: 27,702,524 T135R possibly damaging Het
Zfp970 A G 2: 177,474,870 Q79R possibly damaging Het
Other mutations in Tnxb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Tnxb APN 17 34685629 missense probably damaging 1.00
IGL00424:Tnxb APN 17 34714692 missense probably damaging 1.00
IGL00486:Tnxb APN 17 34692382 missense probably damaging 1.00
IGL00952:Tnxb APN 17 34713128 missense probably damaging 1.00
IGL00974:Tnxb APN 17 34718733 critical splice donor site probably null
IGL01017:Tnxb APN 17 34693808 missense probably damaging 0.98
IGL01082:Tnxb APN 17 34714610 missense probably damaging 0.97
IGL01397:Tnxb APN 17 34714673 missense probably damaging 0.99
IGL01473:Tnxb APN 17 34685701 missense probably damaging 0.99
IGL01642:Tnxb APN 17 34718514 missense probably damaging 1.00
IGL01774:Tnxb APN 17 34688839 missense probably damaging 1.00
IGL01971:Tnxb APN 17 34672297 missense probably damaging 1.00
IGL02016:Tnxb APN 17 34672275 missense probably damaging 0.98
IGL02160:Tnxb APN 17 34714745 missense probably benign 0.01
IGL02473:Tnxb APN 17 34717762 missense probably damaging 1.00
IGL02666:Tnxb APN 17 34684939 missense probably benign 0.20
IGL02831:Tnxb APN 17 34703571 missense possibly damaging 0.93
IGL02838:Tnxb APN 17 34689632 missense possibly damaging 0.74
IGL02965:Tnxb APN 17 34709654 missense possibly damaging 0.93
IGL03155:Tnxb APN 17 34713595 missense probably damaging 1.00
IGL03194:Tnxb APN 17 34695947 nonsense probably null
IGL03215:Tnxb APN 17 34692525 missense possibly damaging 0.66
IGL03256:Tnxb APN 17 34688720 missense probably damaging 1.00
E0370:Tnxb UTSW 17 34678943 missense probably damaging 1.00
R0006:Tnxb UTSW 17 34682292 missense probably benign 0.07
R0049:Tnxb UTSW 17 34709568 missense possibly damaging 0.93
R0050:Tnxb UTSW 17 34673325 missense probably damaging 1.00
R0233:Tnxb UTSW 17 34699033 missense probably benign 0.32
R0233:Tnxb UTSW 17 34699033 missense probably benign 0.32
R0311:Tnxb UTSW 17 34716984 missense probably damaging 0.97
R0326:Tnxb UTSW 17 34698179 missense probably benign 0.32
R0387:Tnxb UTSW 17 34683574 missense probably benign 0.30
R0396:Tnxb UTSW 17 34671733 missense probably damaging 1.00
R0511:Tnxb UTSW 17 34718245 missense probably damaging 0.96
R0540:Tnxb UTSW 17 34671918 missense probably damaging 1.00
R0563:Tnxb UTSW 17 34716947 missense probably benign 0.05
R0575:Tnxb UTSW 17 34717206 missense possibly damaging 0.91
R0586:Tnxb UTSW 17 34672144 missense probably damaging 1.00
R0607:Tnxb UTSW 17 34671918 missense probably damaging 1.00
R0622:Tnxb UTSW 17 34718729 missense probably damaging 1.00
R0624:Tnxb UTSW 17 34683548 missense probably damaging 1.00
R0709:Tnxb UTSW 17 34689354 missense probably damaging 1.00
R0898:Tnxb UTSW 17 34670745 missense probably damaging 1.00
R0970:Tnxb UTSW 17 34698943 missense possibly damaging 0.85
R0972:Tnxb UTSW 17 34685143 missense probably damaging 1.00
R1118:Tnxb UTSW 17 34685043 missense probably damaging 1.00
R1119:Tnxb UTSW 17 34685043 missense probably damaging 1.00
R1226:Tnxb UTSW 17 34688929 missense probably damaging 1.00
R1296:Tnxb UTSW 17 34671577 missense probably damaging 1.00
R1297:Tnxb UTSW 17 34710166 missense probably damaging 0.96
R1349:Tnxb UTSW 17 34710293 missense possibly damaging 0.67
R1356:Tnxb UTSW 17 34695472 missense possibly damaging 0.53
R1372:Tnxb UTSW 17 34710293 missense possibly damaging 0.67
R1521:Tnxb UTSW 17 34711503 missense probably damaging 1.00
R1522:Tnxb UTSW 17 34718638 missense probably damaging 1.00
R1532:Tnxb UTSW 17 34710830 missense probably damaging 1.00
R1735:Tnxb UTSW 17 34717970 missense probably damaging 1.00
R1778:Tnxb UTSW 17 34683574 missense probably benign 0.30
R1802:Tnxb UTSW 17 34703889 missense probably damaging 0.98
R1824:Tnxb UTSW 17 34692333 nonsense probably null
R1838:Tnxb UTSW 17 34678910 missense probably damaging 0.96
R1863:Tnxb UTSW 17 34670874 missense probably damaging 1.00
R1865:Tnxb UTSW 17 34703457 nonsense probably null
R1867:Tnxb UTSW 17 34671847 missense probably damaging 1.00
R1883:Tnxb UTSW 17 34689565 missense probably benign 0.01
R1884:Tnxb UTSW 17 34689565 missense probably benign 0.01
R1889:Tnxb UTSW 17 34695825 missense probably damaging 0.97
R1969:Tnxb UTSW 17 34679081 missense probably benign 0.20
R1989:Tnxb UTSW 17 34683377 missense probably benign 0.08
R1989:Tnxb UTSW 17 34693885 missense probably damaging 1.00
R1991:Tnxb UTSW 17 34671904 missense probably damaging 1.00
R1991:Tnxb UTSW 17 34682251 missense probably damaging 1.00
R2001:Tnxb UTSW 17 34692579 missense possibly damaging 0.82
R2018:Tnxb UTSW 17 34671750 missense probably benign 0.04
R2030:Tnxb UTSW 17 34718469 missense probably damaging 1.00
R2037:Tnxb UTSW 17 34699205 missense probably damaging 1.00
R2103:Tnxb UTSW 17 34682251 missense probably damaging 1.00
R2116:Tnxb UTSW 17 34672227 missense probably damaging 1.00
R2206:Tnxb UTSW 17 34709417 missense possibly damaging 0.86
R2207:Tnxb UTSW 17 34709417 missense possibly damaging 0.86
R2215:Tnxb UTSW 17 34704140 missense possibly damaging 0.93
R2413:Tnxb UTSW 17 34718278 missense probably damaging 0.99
R2680:Tnxb UTSW 17 34703620 missense possibly damaging 0.51
R2910:Tnxb UTSW 17 34672450 missense probably damaging 1.00
R2984:Tnxb UTSW 17 34678662 nonsense probably null
R3120:Tnxb UTSW 17 34692355 missense possibly damaging 0.86
R3429:Tnxb UTSW 17 34672631 nonsense probably null
R3429:Tnxb UTSW 17 34703587 missense probably damaging 0.98
R3552:Tnxb UTSW 17 34718721 missense probably damaging 1.00
R3698:Tnxb UTSW 17 34690433 critical splice donor site probably null
R3720:Tnxb UTSW 17 34712964 missense possibly damaging 0.95
R3841:Tnxb UTSW 17 34698923 missense possibly damaging 0.72
R3848:Tnxb UTSW 17 34690395 missense possibly damaging 0.82
R3886:Tnxb UTSW 17 34718911 missense probably damaging 1.00
R4074:Tnxb UTSW 17 34671871 missense probably benign 0.22
R4159:Tnxb UTSW 17 34711517 missense probably damaging 0.99
R4160:Tnxb UTSW 17 34711517 missense probably damaging 0.99
R4161:Tnxb UTSW 17 34711517 missense probably damaging 0.99
R4181:Tnxb UTSW 17 34709454 missense possibly damaging 0.93
R4210:Tnxb UTSW 17 34710977 missense possibly damaging 0.84
R4275:Tnxb UTSW 17 34698231 missense probably damaging 0.98
R4329:Tnxb UTSW 17 34693864 missense probably damaging 1.00
R4394:Tnxb UTSW 17 34678662 nonsense probably null
R4395:Tnxb UTSW 17 34678662 nonsense probably null
R4397:Tnxb UTSW 17 34678662 nonsense probably null
R4540:Tnxb UTSW 17 34703335 missense possibly damaging 0.86
R4673:Tnxb UTSW 17 34672540 missense probably damaging 0.99
R4719:Tnxb UTSW 17 34689420 missense probably damaging 1.00
R4725:Tnxb UTSW 17 34699067 missense probably damaging 0.99
R4753:Tnxb UTSW 17 34695935 missense possibly damaging 0.71
R4777:Tnxb UTSW 17 34671943 missense probably damaging 1.00
R4837:Tnxb UTSW 17 34718007 missense probably damaging 0.98
R4898:Tnxb UTSW 17 34695592 missense possibly damaging 0.95
R4938:Tnxb UTSW 17 34713632 missense probably damaging 1.00
R5044:Tnxb UTSW 17 34717483 missense probably damaging 1.00
R5100:Tnxb UTSW 17 34710928 missense probably damaging 0.99
R5223:Tnxb UTSW 17 34704078 missense possibly damaging 0.51
R5269:Tnxb UTSW 17 34703608 missense possibly damaging 0.95
R5333:Tnxb UTSW 17 34690231 missense probably damaging 1.00
R5454:Tnxb UTSW 17 34709625 missense possibly damaging 0.71
R5470:Tnxb UTSW 17 34716973 missense probably null 1.00
R5475:Tnxb UTSW 17 34689593 missense probably damaging 1.00
R5574:Tnxb UTSW 17 34711024 missense probably benign
R5596:Tnxb UTSW 17 34688804 missense probably damaging 1.00
R5599:Tnxb UTSW 17 34690202 missense probably damaging 1.00
R5599:Tnxb UTSW 17 34690205 missense probably benign 0.22
R5615:Tnxb UTSW 17 34683418 missense probably damaging 1.00
R5620:Tnxb UTSW 17 34717530 nonsense probably null
R5625:Tnxb UTSW 17 34685211 missense probably benign 0.30
R5734:Tnxb UTSW 17 34698910 missense possibly damaging 0.53
R5896:Tnxb UTSW 17 34672152 missense probably damaging 1.00
R5961:Tnxb UTSW 17 34718635 missense probably damaging 1.00
R5974:Tnxb UTSW 17 34685707 missense probably damaging 1.00
R6091:Tnxb UTSW 17 34710364 missense probably damaging 0.98
R6134:Tnxb UTSW 17 34672012 missense probably damaging 0.96
R6325:Tnxb UTSW 17 34692424 missense probably damaging 1.00
R6358:Tnxb UTSW 17 34678994 missense probably damaging 0.98
R6362:Tnxb UTSW 17 34694388 missense probably damaging 1.00
R6432:Tnxb UTSW 17 34717917 missense probably damaging 1.00
R6461:Tnxb UTSW 17 34671898 missense probably damaging 1.00
R6467:Tnxb UTSW 17 34693924 missense probably damaging 1.00
R6476:Tnxb UTSW 17 34690192 missense probably damaging 0.98
R6477:Tnxb UTSW 17 34719539 missense probably damaging 1.00
R6631:Tnxb UTSW 17 34718248 missense probably damaging 1.00
R6774:Tnxb UTSW 17 34709632 nonsense probably null
R6787:Tnxb UTSW 17 34710736 missense probably benign 0.02
R6805:Tnxb UTSW 17 34698153 missense possibly damaging 0.93
R6860:Tnxb UTSW 17 34713157 missense probably damaging 0.99
R6883:Tnxb UTSW 17 34718519 missense probably damaging 1.00
R7049:Tnxb UTSW 17 34717268 critical splice donor site probably null
R7107:Tnxb UTSW 17 34671340 missense unknown
R7172:Tnxb UTSW 17 34696020 missense probably damaging 1.00
R7206:Tnxb UTSW 17 34704101 missense possibly damaging 0.71
R7219:Tnxb UTSW 17 34679065 missense probably benign 0.08
R7237:Tnxb UTSW 17 34682196 missense possibly damaging 0.82
R7257:Tnxb UTSW 17 34716501 missense probably benign 0.44
R7269:Tnxb UTSW 17 34695454 missense probably damaging 1.00
R7302:Tnxb UTSW 17 34678901 missense probably benign 0.41
X0004:Tnxb UTSW 17 34703415 missense possibly damaging 0.71
X0010:Tnxb UTSW 17 34671934 missense probably damaging 1.00
X0019:Tnxb UTSW 17 34694189 missense possibly damaging 0.51
X0063:Tnxb UTSW 17 34703508 missense probably damaging 0.98
X0064:Tnxb UTSW 17 34694032 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACTCGGGCGAAGACTGTAG -3'
(R):5'- ACACCGTCTTATGCCACAGTC -3'

Sequencing Primer
(F):5'- AGACTGTAGCACGCGGAC -3'
(R):5'- AGTGAAGCCCGGATTGCAC -3'
Posted On2014-08-25