Incidental Mutation 'R1992:Dsg2'
ID223766
Institutional Source Beutler Lab
Gene Symbol Dsg2
Ensembl Gene ENSMUSG00000044393
Gene Namedesmoglein 2
SynonymsD18Ertd293e
MMRRC Submission 040003-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.153) question?
Stock #R1992 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location20558074-20604521 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 20601473 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 836 (K836R)
Ref Sequence ENSEMBL: ENSMUSP00000057096 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059787]
Predicted Effect probably damaging
Transcript: ENSMUST00000059787
AA Change: K836R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000057096
Gene: ENSMUSG00000044393
AA Change: K836R

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
CA 75 162 2.39e-8 SMART
CA 186 275 5.17e-27 SMART
CA 298 392 1.94e-8 SMART
CA 418 502 2.34e-16 SMART
transmembrane domain 618 640 N/A INTRINSIC
low complexity region 822 838 N/A INTRINSIC
low complexity region 914 928 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130296
Meta Mutation Damage Score 0.178 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.5%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the cadherin family of proteins that forms an integral transmembrane component of desmosomes, the multiprotein complexes involved in cell adhesion, organization of the cytoskeleton, cell sorting and cell signaling. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. Mice lacking the encoded protein die in utero. Mutant mice lacking a part of the extracellular adhesive domain of the encoded protein develop cardiac fibrosis and dilation. This gene is located in a cluster of desmosomal cadherin genes on chromosome 18. [provided by RefSeq, Jan 2016]
PHENOTYPE: Homozygous mutation of this gene results in embryonic lethality before somite formation, impaired cell proliferation, and increased apoptosis. Heterozygous mutation of this gene also results in embryonic lethality before somite formation with partial penetrance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 123 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008L16Rik A G 12: 55,338,206 D89G probably damaging Het
1600015I10Rik T A 6: 48,930,769 H234Q probably damaging Het
2310009B15Rik T C 1: 138,853,642 T90A probably damaging Het
4430402I18Rik A G 19: 28,948,624 F130L probably damaging Het
4932438A13Rik A T 3: 37,000,032 H3100L probably benign Het
A930011G23Rik T C 5: 99,233,925 D326G possibly damaging Het
Abcc2 A T 19: 43,807,142 I446F probably damaging Het
Adamts14 A G 10: 61,198,660 Y1150H probably benign Het
Adgrl2 A G 3: 148,817,244 I217T possibly damaging Het
Afap1l1 A T 18: 61,741,771 Y446* probably null Het
Aimp2 G A 5: 143,906,730 A14V probably damaging Het
Akap8 G A 17: 32,316,612 H143Y probably damaging Het
Aldh2 A T 5: 121,575,963 V207E possibly damaging Het
Armc3 T C 2: 19,293,142 Y575H probably damaging Het
Arpp21 T C 9: 112,157,793 E230G probably damaging Het
Arrdc3 G A 13: 80,883,689 D14N probably damaging Het
Atn1 A G 6: 124,745,328 probably benign Het
Atxn7l1 G A 12: 33,358,744 D302N probably damaging Het
Bbs1 T A 19: 4,891,708 H518L probably benign Het
Bmpr1a C A 14: 34,425,093 G241C probably damaging Het
Cacna1b G A 2: 24,732,306 P222L probably damaging Het
Calcrl T C 2: 84,370,511 Y63C probably damaging Het
Cand2 A G 6: 115,785,132 H173R possibly damaging Het
Cap2 T A 13: 46,637,881 Y175N possibly damaging Het
Card14 A T 11: 119,321,821 probably null Het
Cd3d T A 9: 44,985,001 Y29* probably null Het
Cd4 A G 6: 124,867,688 V378A possibly damaging Het
Cluh A T 11: 74,660,002 H318L probably damaging Het
Clvs1 T A 4: 9,281,899 D114E probably benign Het
Cnot4 T A 6: 35,023,409 T548S probably benign Het
Col18a1 T C 10: 77,081,154 I114V unknown Het
Cr2 G A 1: 195,154,150 P1278S possibly damaging Het
Crebbp A T 16: 4,128,697 probably null Het
D430042O09Rik A G 7: 125,820,089 N476S probably benign Het
Dnah7a T G 1: 53,582,676 K1097Q possibly damaging Het
Doc2a T A 7: 126,851,807 probably null Het
Dpp10 A T 1: 123,905,106 V48E probably null Het
Egr2 T C 10: 67,540,027 V164A probably damaging Het
Erbin A T 13: 103,833,713 S1132T probably benign Het
Espn T A 4: 152,128,555 probably null Het
Fam83b A G 9: 76,492,022 S600P probably benign Het
Fanca A T 8: 123,297,812 N425K possibly damaging Het
Flot2 C T 11: 78,058,619 L294F probably damaging Het
Frs2 A G 10: 117,074,554 V301A probably benign Het
Fv1 T A 4: 147,869,161 N61K possibly damaging Het
Fxr2 A G 11: 69,649,833 E339G possibly damaging Het
Gck T C 11: 5,906,515 Y214C probably damaging Het
Gm4858 G T 3: 93,074,037 A121S probably benign Het
Gm5346 T C 8: 43,627,139 K16R probably benign Het
Gm9573 A T 17: 35,618,708 S1529T probably benign Het
Golga3 C G 5: 110,192,973 T551R probably damaging Het
Gorab A G 1: 163,397,056 S59P probably damaging Het
Gsdme C T 6: 50,208,122 V451M probably damaging Het
H2-Bl A C 17: 36,081,046 I216S probably damaging Het
Herc4 T A 10: 63,245,964 V22E possibly damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Hoxa2 A T 6: 52,164,596 S17T probably damaging Het
Hs3st5 A G 10: 36,832,886 Y139C probably damaging Het
Ism1 G A 2: 139,746,017 V221I probably benign Het
Kalrn T G 16: 33,975,738 L1222F probably damaging Het
Kdm4c A G 4: 74,343,394 D602G possibly damaging Het
Ktn1 A G 14: 47,695,521 K711E probably damaging Het
Lce1k A T 3: 92,806,818 C20S unknown Het
Macf1 A G 4: 123,456,695 S3792P probably damaging Het
Maml3 C T 3: 51,690,757 M189I probably benign Het
Mcc C A 18: 44,491,315 E213* probably null Het
Mep1a T G 17: 43,502,682 I13L probably benign Het
Mkrn2 G T 6: 115,609,601 C16F probably damaging Het
Mlh1 C T 9: 111,228,563 A727T probably damaging Het
Naa16 T C 14: 79,356,491 Y344C probably damaging Het
Nebl T A 2: 17,452,510 I80F probably damaging Het
Nlrc4 T A 17: 74,445,633 Y585F probably benign Het
Nrcam A G 12: 44,540,970 K149R probably damaging Het
Nufip1 T A 14: 76,134,847 I467N probably damaging Het
Nup133 A G 8: 123,906,221 I1057T possibly damaging Het
Obscn A T 11: 58,995,827 probably benign Het
Olfr1113 T A 2: 87,213,244 C117* probably null Het
Olfr173 A G 16: 58,796,946 V300A probably benign Het
Olfr177 A C 16: 58,872,511 I213R probably benign Het
Pi4k2a A T 19: 42,115,938 I380F probably damaging Het
Piezo2 A T 18: 63,074,662 L1426Q probably null Het
Pik3cg A T 12: 32,204,025 D654E possibly damaging Het
Poli G T 18: 70,508,987 P714Q probably damaging Het
Polr3f A G 2: 144,536,310 N201D probably benign Het
Ptprz1 A T 6: 22,959,748 K81N probably benign Het
Rbm19 T C 5: 120,133,883 probably null Het
Sec24a C T 11: 51,736,363 V241I probably benign Het
Sgk3 A G 1: 9,880,342 T160A possibly damaging Het
Slc1a4 A G 11: 20,304,375 I497T probably benign Het
Slc26a9 A T 1: 131,762,794 D512V probably damaging Het
Slc43a3 C T 2: 84,957,740 R489C probably damaging Het
Slc5a12 T A 2: 110,621,744 F327L probably benign Het
Slitrk3 A G 3: 73,049,771 V556A possibly damaging Het
Spib T C 7: 44,528,857 E180G probably benign Het
Spint2 T A 7: 29,259,408 N128Y probably damaging Het
Spx G A 6: 142,418,519 G102E probably benign Het
Spz1 T A 13: 92,575,658 E103D possibly damaging Het
Sstr2 T C 11: 113,624,669 I138T probably benign Het
Sytl3 T A 17: 6,733,049 I206N possibly damaging Het
Tcaf2 T C 6: 42,629,857 T388A probably benign Het
Thap12 T C 7: 98,716,365 V580A possibly damaging Het
Tlr5 T A 1: 182,974,347 D405E probably damaging Het
Tnxb T C 17: 34,671,904 V407A probably damaging Het
Tpx2 T A 2: 152,890,624 M606K probably benign Het
Trim43a T G 9: 88,584,259 L211R probably damaging Het
Trim46 A T 3: 89,237,701 Y489N probably damaging Het
Ttc28 C T 5: 111,276,322 S1485L probably benign Het
Ttll8 T C 15: 88,914,451 T694A probably benign Het
Txnl1 T C 18: 63,679,514 T70A probably benign Het
Ube3a C T 7: 59,303,787 A823V probably damaging Het
Ubqln5 C A 7: 104,129,534 V28F probably damaging Het
Ulk1 T A 5: 110,787,151 Q972L probably damaging Het
Unc93b1 T C 19: 3,944,062 Y398H probably benign Het
Usp1 A G 4: 98,934,294 D615G probably benign Het
Utp15 A G 13: 98,250,912 C385R probably benign Het
Vmn2r91 T A 17: 18,135,880 V603D probably damaging Het
Whamm C T 7: 81,591,771 R277* probably null Het
Wnt8a A G 18: 34,544,884 D115G probably damaging Het
Yjefn3 A T 8: 69,888,995 probably null Het
Ywhab A T 2: 164,011,887 I95F probably damaging Het
Zfp143 C T 7: 110,061,282 probably benign Het
Zfp607b C G 7: 27,702,524 T135R possibly damaging Het
Zfp970 A G 2: 177,474,870 Q79R possibly damaging Het
Other mutations in Dsg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00425:Dsg2 APN 18 20601769 missense probably benign 0.10
IGL00979:Dsg2 APN 18 20582767 missense probably damaging 0.99
IGL01081:Dsg2 APN 18 20589942 unclassified probably benign
IGL01358:Dsg2 APN 18 20601793 missense probably damaging 0.98
IGL02002:Dsg2 APN 18 20579176 missense probably damaging 1.00
IGL02263:Dsg2 APN 18 20590020 missense possibly damaging 0.70
IGL02410:Dsg2 APN 18 20602132 missense probably benign 0.04
IGL02553:Dsg2 APN 18 20592410 missense probably damaging 1.00
IGL03036:Dsg2 APN 18 20579077 missense probably damaging 0.99
dissolute UTSW 18 20595951 splice site probably null
Dysjunction UTSW 18 20582939 nonsense probably null
weg UTSW 18 20580651 nonsense probably null
R0094:Dsg2 UTSW 18 20591853 missense probably benign 0.08
R0094:Dsg2 UTSW 18 20591853 missense probably benign 0.08
R0105:Dsg2 UTSW 18 20602054 missense probably benign 0.03
R0105:Dsg2 UTSW 18 20602054 missense probably benign 0.03
R0112:Dsg2 UTSW 18 20583042 missense probably benign 0.02
R0305:Dsg2 UTSW 18 20582695 splice site probably benign
R0380:Dsg2 UTSW 18 20582939 nonsense probably null
R0401:Dsg2 UTSW 18 20592508 splice site probably benign
R0421:Dsg2 UTSW 18 20579391 missense probably damaging 1.00
R0578:Dsg2 UTSW 18 20594234 missense probably benign 0.00
R0667:Dsg2 UTSW 18 20573499 missense possibly damaging 0.50
R1223:Dsg2 UTSW 18 20573493 missense probably benign 0.23
R1433:Dsg2 UTSW 18 20582723 missense probably damaging 0.98
R1543:Dsg2 UTSW 18 20594211 missense probably benign 0.33
R1730:Dsg2 UTSW 18 20591880 missense probably benign 0.01
R1783:Dsg2 UTSW 18 20591880 missense probably benign 0.01
R1946:Dsg2 UTSW 18 20580548 missense probably damaging 1.00
R1991:Dsg2 UTSW 18 20601473 missense probably damaging 1.00
R2027:Dsg2 UTSW 18 20583004 unclassified probably null
R2109:Dsg2 UTSW 18 20592289 missense probably benign 0.00
R2143:Dsg2 UTSW 18 20579161 missense probably damaging 1.00
R2201:Dsg2 UTSW 18 20596054 missense probably damaging 1.00
R2343:Dsg2 UTSW 18 20602298 missense probably damaging 0.99
R2937:Dsg2 UTSW 18 20579128 missense probably damaging 1.00
R3710:Dsg2 UTSW 18 20602117 missense probably damaging 1.00
R3734:Dsg2 UTSW 18 20601947 missense probably benign 0.41
R3773:Dsg2 UTSW 18 20591862 missense probably damaging 1.00
R4176:Dsg2 UTSW 18 20580663 missense probably benign 0.25
R4213:Dsg2 UTSW 18 20598514 missense probably benign 0.01
R4299:Dsg2 UTSW 18 20595951 splice site probably null
R4515:Dsg2 UTSW 18 20601387 missense probably benign
R4649:Dsg2 UTSW 18 20602245 missense possibly damaging 0.56
R4940:Dsg2 UTSW 18 20579430 missense probably damaging 1.00
R4949:Dsg2 UTSW 18 20590184 missense probably damaging 1.00
R4998:Dsg2 UTSW 18 20601521 missense probably benign 0.26
R5078:Dsg2 UTSW 18 20596083 critical splice donor site probably null
R5155:Dsg2 UTSW 18 20598658 missense possibly damaging 0.67
R5398:Dsg2 UTSW 18 20579133 missense probably benign 0.45
R5503:Dsg2 UTSW 18 20580651 nonsense probably null
R6133:Dsg2 UTSW 18 20590089 missense probably benign 0.00
R6163:Dsg2 UTSW 18 20598669 critical splice donor site probably null
R6226:Dsg2 UTSW 18 20579449 missense probably damaging 0.98
R6228:Dsg2 UTSW 18 20594293 critical splice donor site probably null
R6241:Dsg2 UTSW 18 20590217 splice site probably null
R6482:Dsg2 UTSW 18 20601314 missense possibly damaging 0.69
R6524:Dsg2 UTSW 18 20583036 missense probably damaging 1.00
R6856:Dsg2 UTSW 18 20601802 missense probably damaging 0.98
R7058:Dsg2 UTSW 18 20592275 missense probably benign 0.00
R7108:Dsg2 UTSW 18 20601863 missense probably damaging 1.00
R7149:Dsg2 UTSW 18 20579454 missense probably damaging 0.98
R7207:Dsg2 UTSW 18 20601459 missense probably damaging 0.99
R7256:Dsg2 UTSW 18 20591931 missense possibly damaging 0.96
R7315:Dsg2 UTSW 18 20579160 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TTTTGTTTAGAAAGCGGCCTCC -3'
(R):5'- TCTCAGTGACGATTTCCTGTG -3'

Sequencing Primer
(F):5'- GTTTAGAAAGCGGCCTCCTACAATG -3'
(R):5'- CAGTGACGATTTCCTGTGTGACTTTC -3'
Posted On2014-08-25