Mutagenetix > Incidental Mutations

Incidental Mutation 'R0142:Nfix'

22383

Institutional Source

Beutler Lab

Gene Symbol

Nfix

Ensembl Gene

ENSMUSG00000001911

Gene Name

nuclear factor I/X

Synonyms

MMRRC Submission

038427-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.330) question?

Stock #

R0142 (G1)

Quality Score

225

Status

Validated (trace)

Chromosome

Chromosomal Location

84699876-84800344 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 84721686 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Glutamic Acid at position 404 (V404E)

Ref Sequence

ENSEMBL: ENSMUSP00000115691 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000076715] [ENSMUST00000098571] [ENSMUST00000099070] [ENSMUST00000109762] [ENSMUST00000109764] [ENSMUST00000126806]

Predicted Effect

probably damaging
Transcript: ENSMUST00000076715
AA Change: V363E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000076005
Gene: ENSMUSG00000001911
AA Change: V363E

Domain	Start	End	E-Value	Type
Pfam:NfI_DNAbd_pre-N	3	46	4.1e-30	PFAM
DWA	67	175	1.86e-18	SMART
low complexity region	188	199	N/A	INTRINSIC
Pfam:CTF_NFI	213	322	7.4e-32	PFAM
Pfam:CTF_NFI	313	396	3.8e-19	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000098571

SMART Domains

Protein: ENSMUSP00000096170
Gene: ENSMUSG00000074203

Domain	Start	End	E-Value	Type
low complexity region	21	31	N/A	INTRINSIC
low complexity region	34	51	N/A	INTRINSIC
low complexity region	73	85	N/A	INTRINSIC
low complexity region	91	103	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000099070
AA Change: V404E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000096669
Gene: ENSMUSG00000001911
AA Change: V404E

Domain	Start	End	E-Value	Type
Pfam:NfI_DNAbd_pre-N	3	46	4.7e-30	PFAM
DWA	67	175	1.86e-18	SMART
low complexity region	188	199	N/A	INTRINSIC
Pfam:CTF_NFI	213	437	2.7e-58	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000109762
AA Change: V354E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000105384
Gene: ENSMUSG00000001911
AA Change: V354E

Domain	Start	End	E-Value	Type
Pfam:NfI_DNAbd_pre-N	1	38	1.1e-27	PFAM
DWA	59	167	1.86e-18	SMART
low complexity region	180	191	N/A	INTRINSIC
Pfam:CTF_NFI	205	312	5.4e-32	PFAM
Pfam:CTF_NFI	305	387	3.6e-19	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000109764
AA Change: V396E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000105386
Gene: ENSMUSG00000001911
AA Change: V396E

Domain	Start	End	E-Value	Type
Pfam:NfI_DNAbd_pre-N	1	38	1e-28	PFAM
DWA	59	167	1.86e-18	SMART
low complexity region	180	191	N/A	INTRINSIC
Pfam:CTF_NFI	205	494	9.8e-137	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000126806
AA Change: V404E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000115691
Gene: ENSMUSG00000001911
AA Change: V404E

Domain	Start	End	E-Value	Type
Pfam:NfI_DNAbd_pre-N	3	46	7.1e-31	PFAM
DWA	67	175	1.86e-18	SMART
low complexity region	188	199	N/A	INTRINSIC
Pfam:CTF_NFI	213	488	1.5e-83	PFAM

Meta Mutation Damage Score

0.186

Coding Region Coverage

1x: 98.9%
3x: 97.9%
10x: 95.0%
20x: 87.6%

Validation Efficiency

92% (61/66)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a transcription factor that binds the palindromic sequence 5'-TTGGCNNNNNGCCAA-3 in viral and cellular promoters. The encoded protein can also stimulate adenovirus replication in vitro. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2012]
PHENOTYPE: Mice homozygous for a mutation in this gene display postnatal lethality, hydrocephalus, partial agenesis of the corpus callosum, deformation of the spine due to delayed vertebral body ossification, degeneration of intervertebral disks, decreased mineralization and impaired endochondral ossification. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9930021J03Rik	A	G	19: 29,718,254	S1347P	possibly damaging	Het
Abca6	T	G	11: 110,188,641	D1229A	probably damaging	Het
Abhd8	A	C	8: 71,461,862	F41V	probably damaging	Het
Ago4	T	G	4: 126,516,932	E222A	probably benign	Het
Ap3b2	T	C	7: 81,473,080	I470V	probably damaging	Het
Bcl9l	C	T	9: 44,507,112	T749M	probably benign	Het
Bicc1	T	C	10: 70,925,370	K937E	probably damaging	Het
Bmi1	G	A	2: 18,683,284		probably null	Het
Boc	A	C	16: 44,490,241	I772S	probably damaging	Het
C2	T	A	17: 34,873,528	I178F	possibly damaging	Het
Cacna1c	G	T	6: 118,603,882	A1416E	probably damaging	Het
Chst10	A	G	1: 38,871,729	L118P	probably damaging	Het
Crybg1	G	A	10: 43,999,063	T683I	possibly damaging	Het
Cul5	C	T	9: 53,635,050	V314I	probably damaging	Het
Dnajc17	C	A	2: 119,179,934	R211I	probably benign	Het
Emilin1	A	G	5: 30,913,920	T16A	probably benign	Het
Ercc6l2	A	C	13: 63,872,506		probably benign	Het
Fsd2	T	A	7: 81,559,935	D53V	probably damaging	Het
Galnt13	A	G	2: 55,098,603	D479G	probably damaging	Het
Grk3	A	T	5: 112,915,053	W643R	probably damaging	Het
Hdgf	G	A	3: 87,913,109	A4T	possibly damaging	Het
Hnrnpr	T	A	4: 136,327,282	V182E	probably damaging	Het
Ipo13	A	C	4: 117,905,569	L279R	probably damaging	Het
Itga9	C	A	9: 118,636,586	N169K	probably damaging	Het
Jph3	A	G	8: 121,753,371	T263A	possibly damaging	Het
Jph4	G	T	14: 55,108,326	Q625K	probably benign	Het
Kctd3	A	C	1: 188,996,398		probably null	Het
Kif26b	A	T	1: 178,915,389	S570C	probably damaging	Het
Klhl5	G	A	5: 65,143,350	W164*	probably null	Het
Lacc1	A	T	14: 77,030,799	H357Q	probably benign	Het
Lama2	A	G	10: 27,187,845	I1316T	probably benign	Het
Lcp2	C	T	11: 34,082,418	P332L	probably damaging	Het
Map3k6	A	T	4: 133,250,946	H1033L	probably benign	Het
Mfsd2b	A	G	12: 4,866,234	V252A	probably benign	Het
Myo16	T	A	8: 10,569,790	I1447N	probably benign	Het
Myo19	G	A	11: 84,894,603	R224H	probably damaging	Het
Myo5a	C	T	9: 75,160,574	H637Y	probably benign	Het
Nek10	C	T	14: 14,861,560	R539C	possibly damaging	Het
Nr1i2	T	C	16: 38,253,006	R203G	probably benign	Het
Nup210l	G	A	3: 90,172,113	G968D	probably damaging	Het
Olfr1494	A	T	19: 13,749,255	I50F	probably benign	Het
Olfr697	G	T	7: 106,741,765	H56Q	probably benign	Het
Olfr884	A	T	9: 38,048,110	H296L	probably benign	Het
Phlpp2	C	T	8: 109,907,513	R242W	probably damaging	Het
Plcz1	A	G	6: 140,007,697	F398S	probably damaging	Het
Ppfibp2	C	A	7: 107,744,177	P808T	probably damaging	Het
Srpk2	T	C	5: 23,527,930	K239E	probably damaging	Het
Svep1	A	G	4: 58,118,232	V830A	probably benign	Het
Tesc	A	T	5: 118,056,570	I149F	possibly damaging	Het
Thsd7a	A	G	6: 12,418,335	W632R	probably damaging	Het
Tmprss9	A	G	10: 80,894,378	D704G	possibly damaging	Het
Tob1	T	C	11: 94,214,597	Y320H	probably damaging	Het
Trpm3	G	T	19: 22,987,916	D1582Y	probably damaging	Het
Ttc28	A	G	5: 111,277,457	K1716R	probably benign	Het
Uqcrfs1	A	G	13: 30,540,942	V205A	probably benign	Het
Usp29	G	A	7: 6,962,335	M392I	probably benign	Het
Uspl1	A	T	5: 149,188,349	Y22F	possibly damaging	Het
Virma	C	A	4: 11,548,783	N1780K	probably benign	Het
Vmn1r56	C	T	7: 5,196,373	A82T	probably benign	Het
Vmn2r5	A	T	3: 64,492,588	C553S	probably damaging	Het
Vwce	A	T	19: 10,664,612	R901W	probably damaging	Het
Wdpcp	C	A	11: 21,857,444		probably null	Het
Zfp423	A	T	8: 87,780,340	C1000*	probably null	Het
Zscan20	A	G	4: 128,585,837	F954L	probably benign	Het

Other mutations in Nfix

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00913:Nfix	APN	8	84726477	missense	probably damaging	0.99
IGL01919:Nfix	APN	8	84726474	missense	probably damaging	1.00
IGL01950:Nfix	APN	8	84713786	makesense	probably null
IGL02862:Nfix	APN	8	84713846	missense	probably benign	0.07
R0309:Nfix	UTSW	8	84721774	missense	probably damaging	1.00
R0600:Nfix	UTSW	8	84726526	missense	probably damaging	1.00
R0622:Nfix	UTSW	8	84726482	missense	probably damaging	0.99
R0628:Nfix	UTSW	8	84726526	missense	probably damaging	1.00
R0882:Nfix	UTSW	8	84727925	missense	probably damaging	1.00
R0893:Nfix	UTSW	8	84726526	missense	probably damaging	1.00
R0973:Nfix	UTSW	8	84726526	missense	probably damaging	1.00
R0973:Nfix	UTSW	8	84726526	missense	probably damaging	1.00
R0974:Nfix	UTSW	8	84726526	missense	probably damaging	1.00
R0975:Nfix	UTSW	8	84726526	missense	probably damaging	1.00
R1014:Nfix	UTSW	8	84726526	missense	probably damaging	1.00
R1015:Nfix	UTSW	8	84726526	missense	probably damaging	1.00
R1162:Nfix	UTSW	8	84726526	missense	probably damaging	1.00
R1241:Nfix	UTSW	8	84726526	missense	probably damaging	1.00
R1381:Nfix	UTSW	8	84726526	missense	probably damaging	1.00
R1513:Nfix	UTSW	8	84726526	missense	probably damaging	1.00
R1521:Nfix	UTSW	8	84726526	missense	probably damaging	1.00
R1618:Nfix	UTSW	8	84726526	missense	probably damaging	1.00
R1865:Nfix	UTSW	8	84772275	missense	possibly damaging	0.73
R1912:Nfix	UTSW	8	84721677	missense	probably damaging	1.00
R1974:Nfix	UTSW	8	84726526	missense	probably damaging	1.00
R2208:Nfix	UTSW	8	84716247	frame shift	probably null
R2251:Nfix	UTSW	8	84716170	missense	probably benign	0.03
R2268:Nfix	UTSW	8	84716247	frame shift	probably null
R2270:Nfix	UTSW	8	84716247	frame shift	probably null
R2272:Nfix	UTSW	8	84727175	missense	probably damaging	1.00
R2346:Nfix	UTSW	8	84716247	frame shift	probably null
R2350:Nfix	UTSW	8	84716247	frame shift	probably null
R2963:Nfix	UTSW	8	84716247	frame shift	probably null
R2983:Nfix	UTSW	8	84716247	frame shift	probably null
R3008:Nfix	UTSW	8	84716247	frame shift	probably null
R3727:Nfix	UTSW	8	84716247	frame shift	probably null
R3791:Nfix	UTSW	8	84716247	frame shift	probably null
R4163:Nfix	UTSW	8	84716247	frame shift	probably null
R4164:Nfix	UTSW	8	84716247	frame shift	probably null
R4201:Nfix	UTSW	8	84716247	frame shift	probably null
R4206:Nfix	UTSW	8	84716247	frame shift	probably null
R4609:Nfix	UTSW	8	84726490	missense	probably damaging	1.00
R4801:Nfix	UTSW	8	84716247	frame shift	probably null
R4802:Nfix	UTSW	8	84716247	frame shift	probably null
R4914:Nfix	UTSW	8	84771829	missense	probably benign	0.00
R4915:Nfix	UTSW	8	84771829	missense	probably benign	0.00
R4916:Nfix	UTSW	8	84771829	missense	probably benign	0.00
R4918:Nfix	UTSW	8	84771829	missense	probably benign	0.00
R5013:Nfix	UTSW	8	84772084	missense	possibly damaging	0.86
R5290:Nfix	UTSW	8	84713777	nonsense	probably null
R6418:Nfix	UTSW	8	84727149	missense	probably benign	0.01
R6554:Nfix	UTSW	8	84727650	missense	possibly damaging	0.93
R6786:Nfix	UTSW	8	84727647	missense	probably damaging	1.00
T0970:Nfix	UTSW	8	84726483	missense	possibly damaging	0.93

Predicted Primers

PCR Primer
(F):5'- ATCCTTGTGAGCCCTTAGACGGAC -3'
(R):5'- GTTTTGTGCCTGACACAGTGCTTC -3'

Sequencing Primer
(F):5'- ggacagatggacagacagac -3'
(R):5'- GACACAGTGCTTCTGCCC -3'

Posted On

2013-04-16