Incidental Mutation 'R2020:Pcca'
ID223884
Institutional Source Beutler Lab
Gene Symbol Pcca
Ensembl Gene ENSMUSG00000041650
Gene Namepropionyl-Coenzyme A carboxylase, alpha polypeptide
SynonymsC79630
MMRRC Submission 040029-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2020 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location122534324-122891100 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 122813222 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 101 (M101K)
Ref Sequence ENSEMBL: ENSMUSP00000135266 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038374] [ENSMUST00000110679] [ENSMUST00000152383]
Predicted Effect probably benign
Transcript: ENSMUST00000038374
AA Change: M621K

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000038763
Gene: ENSMUSG00000041650
AA Change: M621K

DomainStartEndE-ValueType
Pfam:CPSase_L_chain 58 167 2.1e-48 PFAM
Pfam:ATP-grasp_4 169 351 3.8e-15 PFAM
Pfam:RimK 170 372 5.6e-7 PFAM
Pfam:CPSase_L_D2 172 381 2.8e-87 PFAM
Pfam:ATP-grasp 181 351 9.8e-10 PFAM
Pfam:Dala_Dala_lig_C 192 349 7.7e-12 PFAM
Biotin_carb_C 393 501 4.27e-46 SMART
Pfam:Biotin_lipoyl 656 723 1e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110679
SMART Domains Protein: ENSMUSP00000135487
Gene: ENSMUSG00000041625

DomainStartEndE-ValueType
Pfam:AIG2 4 71 3.7e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128893
Predicted Effect unknown
Transcript: ENSMUST00000132444
AA Change: M28K
Predicted Effect possibly damaging
Transcript: ENSMUST00000152383
AA Change: M101K

PolyPhen 2 Score 0.645 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000135266
Gene: ENSMUSG00000041650
AA Change: M101K

DomainStartEndE-ValueType
Pfam:SLT_beta 32 106 3.4e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156755
Predicted Effect probably benign
Transcript: ENSMUST00000177312
Meta Mutation Damage Score 0.062 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.6%
Validation Efficiency 99% (87/88)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the alpha subunit of the heterodimeric mitochondrial enzyme Propionyl-CoA carboxylase. PCCA encodes the biotin-binding region of this enzyme. Mutations in either PCCA or PCCB (encoding the beta subunit) lead to an enzyme deficiency resulting in propionic acidemia. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, May 2010]
PHENOTYPE: Homozygous null mice die 24-36 hours after birth due to accelerated ketoacidosis. Death is preceded by reduced milk intake, poor movement, dehydration, accumulation of propionyl-CoA, ketonuria, increased fat deposition and glycogen consumption in liver, and enlarged kidney collecting ducts. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600012P17Rik C A 1: 158,968,912 noncoding transcript Het
9530053A07Rik T C 7: 28,155,594 S1882P probably benign Het
Adam17 G A 12: 21,349,875 R177C probably damaging Het
Ak7 G A 12: 105,745,332 probably null Het
Akap9 T C 5: 3,961,967 V890A probably damaging Het
Alg6 A G 4: 99,738,132 N59S probably damaging Het
Alkbh5 G T 11: 60,538,549 A43S probably benign Het
Anxa2 C A 9: 69,483,817 D162E probably damaging Het
Arap1 A G 7: 101,401,518 H1136R probably benign Het
Arhgap18 A G 10: 26,854,904 R121G probably benign Het
Arhgef4 A T 1: 34,723,810 T716S unknown Het
Atg2a T C 19: 6,250,269 probably null Het
Ccdc27 T C 4: 154,033,313 I480V probably null Het
Cdipt T C 7: 126,976,933 V20A possibly damaging Het
Cgrrf1 C T 14: 46,830,445 probably benign Het
Chd7 G A 4: 8,855,226 V2152I probably benign Het
Chd8 T A 14: 52,215,241 S1274C probably damaging Het
Chuk A T 19: 44,107,343 M17K possibly damaging Het
Col14a1 C T 15: 55,446,181 probably benign Het
Col20a1 G A 2: 181,013,163 probably null Het
Cped1 A G 6: 22,143,964 I570V probably benign Het
Cul9 C G 17: 46,522,175 A1326P probably damaging Het
Ddx27 A C 2: 167,033,771 Q674P probably damaging Het
Dennd6a T A 14: 26,612,003 F131L probably damaging Het
Dhx38 G A 8: 109,556,869 probably benign Het
Dido1 G T 2: 180,659,585 N2175K unknown Het
Dmxl1 T A 18: 49,889,558 Y1654* probably null Het
Dock7 T A 4: 98,959,101 H1658L probably damaging Het
Dync2h1 T A 9: 7,122,772 E2061D probably damaging Het
Dync2h1 T C 9: 7,162,925 I555V probably benign Het
Eif2ak2 T C 17: 78,863,963 E337G possibly damaging Het
Fabp12 T A 3: 10,250,149 D46V probably benign Het
Fech C T 18: 64,478,727 E79K probably damaging Het
Flnc A T 6: 29,444,363 I693F probably damaging Het
Foxp2 G A 6: 15,324,644 C97Y possibly damaging Het
Grin2b A G 6: 135,733,896 M884T probably benign Het
Gtf2ird1 T C 5: 134,417,093 D28G probably damaging Het
Gtf3c4 C A 2: 28,833,894 G468W possibly damaging Het
Ift172 A T 5: 31,267,241 L201* probably null Het
Il1rl2 C A 1: 40,365,214 S498R probably damaging Het
Ildr1 C T 16: 36,725,541 R489W probably damaging Het
Itga10 G A 3: 96,652,490 G487D probably damaging Het
Klk8 A G 7: 43,799,216 N128D probably benign Het
Lgr6 G A 1: 135,075,275 T79M probably damaging Het
Med6 T C 12: 81,573,877 T232A probably benign Het
Mgat4e A G 1: 134,541,322 L328P probably damaging Het
Mttp A G 3: 138,118,402 Y138H probably damaging Het
Ngef T C 1: 87,545,968 R31G probably benign Het
Nipsnap2 C A 5: 129,753,223 probably null Het
Nlgn2 G T 11: 69,828,441 N194K probably damaging Het
Olfr1026 A G 2: 85,923,743 I158M probably benign Het
Olfr1245 A T 2: 89,574,961 M255K possibly damaging Het
Olfr1450 G A 19: 12,954,332 V248I possibly damaging Het
Olfr357 G A 2: 36,997,652 V281M possibly damaging Het
Olfr894 A G 9: 38,219,432 Y203C possibly damaging Het
Plekha6 A G 1: 133,284,970 T671A possibly damaging Het
Prex2 G A 1: 11,162,312 V868M probably damaging Het
Prkcq G A 2: 11,279,521 V501I probably benign Het
Prom1 T A 5: 44,011,253 probably benign Het
Ptprd A G 4: 76,133,161 V41A probably damaging Het
Rab39 C T 9: 53,686,398 G189E possibly damaging Het
Ret T C 6: 118,180,382 K236E possibly damaging Het
Rfx6 G A 10: 51,720,057 probably null Het
Rnf213 A G 11: 119,461,918 T3916A probably damaging Het
Rpn1 A G 6: 88,095,683 N336S probably damaging Het
Sag G A 1: 87,805,315 A2T probably damaging Het
Sco2 T C 15: 89,371,860 Y197C probably damaging Het
Sec23b T C 2: 144,566,944 I183T possibly damaging Het
Sec24b C T 3: 129,987,728 V1166M probably damaging Het
Slc27a5 A T 7: 12,993,412 F361Y probably damaging Het
Spaca9 A G 2: 28,696,001 L17P probably damaging Het
Sqor T C 2: 122,804,107 probably null Het
Stx18 A G 5: 38,135,244 H230R probably damaging Het
Tas2r130 A T 6: 131,630,769 I21N probably damaging Het
Tcaf3 A G 6: 42,593,724 S365P possibly damaging Het
Tinagl1 G A 4: 130,166,972 H351Y probably damaging Het
Tmc2 T C 2: 130,232,385 Y333H probably damaging Het
Trp53bp2 A T 1: 182,442,819 T395S probably damaging Het
Tsc22d1 T C 14: 76,418,333 S751P probably damaging Het
Ttc30a1 A G 2: 75,980,935 V268A probably benign Het
Ttn A G 2: 76,827,024 probably benign Het
Ugdh T C 5: 65,416,925 Y425C probably damaging Het
Vmn1r115 G A 7: 20,844,169 L273F probably null Het
Vmn2r109 A T 17: 20,541,186 C636* probably null Het
Vmn2r59 A C 7: 42,043,779 Y466D probably damaging Het
Zic5 C T 14: 122,464,830 G163D unknown Het
Other mutations in Pcca
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00467:Pcca APN 14 122582629 missense probably benign 0.22
IGL00906:Pcca APN 14 122690133 missense probably benign 0.34
IGL00975:Pcca APN 14 122876900 missense probably damaging 1.00
IGL01329:Pcca APN 14 122690133 missense possibly damaging 0.50
IGL01353:Pcca APN 14 122582617 missense probably damaging 0.98
IGL01672:Pcca APN 14 122690145 missense probably benign 0.02
IGL02621:Pcca APN 14 122684979 missense probably damaging 0.99
IGL02695:Pcca APN 14 122582738 splice site probably benign
IGL02749:Pcca APN 14 122534388 missense probably benign 0.00
IGL02971:Pcca APN 14 122889533 missense probably damaging 0.96
IGL03290:Pcca APN 14 122585106 missense possibly damaging 0.52
IGL03052:Pcca UTSW 14 122887101 missense probably benign
R0549:Pcca UTSW 14 122638377 splice site probably benign
R0866:Pcca UTSW 14 122889545 missense possibly damaging 0.95
R1498:Pcca UTSW 14 122616818 missense probably damaging 1.00
R1749:Pcca UTSW 14 122701130 missense probably damaging 0.97
R2002:Pcca UTSW 14 122887065 missense probably benign 0.00
R2086:Pcca UTSW 14 122686115 missense probably damaging 0.99
R3780:Pcca UTSW 14 122684885 missense probably damaging 1.00
R5023:Pcca UTSW 14 122790398 missense probably damaging 1.00
R5643:Pcca UTSW 14 122887069 missense probably damaging 1.00
R5644:Pcca UTSW 14 122887069 missense probably damaging 1.00
R5943:Pcca UTSW 14 122658776 missense probably damaging 0.99
R5966:Pcca UTSW 14 122668586 missense probably damaging 0.96
R6295:Pcca UTSW 14 122658775 missense probably benign 0.10
R6317:Pcca UTSW 14 122582623 missense probably damaging 1.00
R6319:Pcca UTSW 14 122582623 missense probably damaging 1.00
R6361:Pcca UTSW 14 122638382 missense probably benign 0.07
R6989:Pcca UTSW 14 122650288 missense probably damaging 1.00
X0026:Pcca UTSW 14 122616791 missense possibly damaging 0.51
Predicted Primers PCR Primer
(F):5'- AGGCTTTTGAAGAGCAGCGC -3'
(R):5'- TCAACACAGAAGCTTTACTCACATGTC -3'

Sequencing Primer
(F):5'- TGAAGAGCAGCGCCTTTG -3'
(R):5'- GTCCTGCTTCTCACACCAAGATG -3'
Posted On2014-08-25