Incidental Mutation 'R2021:Stard9'
ID223939
Institutional Source Beutler Lab
Gene Symbol Stard9
Ensembl Gene ENSMUSG00000033705
Gene NameSTART domain containing 9
SynonymsE230025N21Rik, Kif16a, 4831403C07Rik, N-3 kinesin
MMRRC Submission 040030-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.275) question?
Stock #R2021 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location120629121-120731895 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 120704235 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 3658 (T3658A)
Ref Sequence ENSEMBL: ENSMUSP00000136055 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000140843] [ENSMUST00000154193] [ENSMUST00000180041]
Predicted Effect probably benign
Transcript: ENSMUST00000070420
SMART Domains Protein: ENSMUSP00000070111
Gene: ENSMUSG00000033705

DomainStartEndE-ValueType
coiled coil region 97 138 N/A INTRINSIC
low complexity region 142 151 N/A INTRINSIC
low complexity region 157 174 N/A INTRINSIC
low complexity region 234 255 N/A INTRINSIC
Pfam:START 274 469 3.2e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000140843
SMART Domains Protein: ENSMUSP00000117178
Gene: ENSMUSG00000033705

DomainStartEndE-ValueType
FHA 63 115 2.8e-4 SMART
coiled coil region 334 354 N/A INTRINSIC
low complexity region 573 584 N/A INTRINSIC
low complexity region 866 871 N/A INTRINSIC
low complexity region 1023 1035 N/A INTRINSIC
low complexity region 1234 1248 N/A INTRINSIC
low complexity region 1765 1775 N/A INTRINSIC
low complexity region 2546 2559 N/A INTRINSIC
low complexity region 2953 2963 N/A INTRINSIC
low complexity region 3269 3281 N/A INTRINSIC
low complexity region 3421 3435 N/A INTRINSIC
coiled coil region 3767 3808 N/A INTRINSIC
low complexity region 3812 3821 N/A INTRINSIC
low complexity region 3827 3844 N/A INTRINSIC
low complexity region 3904 3925 N/A INTRINSIC
SCOP:d1jssa_ 3946 4142 1e-28 SMART
Blast:START 3947 4143 1e-10 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000154193
SMART Domains Protein: ENSMUSP00000116900
Gene: ENSMUSG00000033705

DomainStartEndE-ValueType
low complexity region 63 77 N/A INTRINSIC
coiled coil region 409 450 N/A INTRINSIC
low complexity region 454 463 N/A INTRINSIC
low complexity region 469 486 N/A INTRINSIC
low complexity region 546 567 N/A INTRINSIC
SCOP:d1jssa_ 588 784 4e-29 SMART
Blast:START 589 785 6e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000180041
AA Change: T3658A

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000136055
Gene: ENSMUSG00000033705
AA Change: T3658A

DomainStartEndE-ValueType
KISc 1 392 3.31e-143 SMART
low complexity region 398 409 N/A INTRINSIC
FHA 481 533 2.8e-4 SMART
coiled coil region 752 772 N/A INTRINSIC
low complexity region 991 1002 N/A INTRINSIC
low complexity region 1284 1289 N/A INTRINSIC
low complexity region 1441 1453 N/A INTRINSIC
low complexity region 1652 1666 N/A INTRINSIC
low complexity region 2183 2193 N/A INTRINSIC
low complexity region 2964 2977 N/A INTRINSIC
low complexity region 3371 3381 N/A INTRINSIC
low complexity region 3687 3699 N/A INTRINSIC
low complexity region 3839 3853 N/A INTRINSIC
coiled coil region 4185 4226 N/A INTRINSIC
low complexity region 4230 4239 N/A INTRINSIC
low complexity region 4245 4262 N/A INTRINSIC
low complexity region 4322 4343 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik T C 6: 48,931,451 S462P probably damaging Het
Ablim1 A T 19: 57,047,018 S316T probably damaging Het
Alox8 C T 11: 69,186,288 V460I probably damaging Het
Arvcf G A 16: 18,399,732 A491T probably damaging Het
Asnsd1 A G 1: 53,347,227 S414P possibly damaging Het
Btbd7 A G 12: 102,790,709 L706P probably damaging Het
Camk2d T A 3: 126,780,456 W171R probably damaging Het
Casc3 T A 11: 98,821,506 S124T probably benign Het
Casp8ap2 T C 4: 32,644,560 V1211A probably benign Het
Ccdc182 T C 11: 88,294,136 V14A possibly damaging Het
Ccdc80 A T 16: 45,122,912 Q795L probably damaging Het
Ccdc88a T G 11: 29,503,480 S1614R probably damaging Het
Clcn6 A G 4: 148,010,652 probably null Het
Cubn A G 2: 13,308,549 V3070A probably benign Het
Dst G A 1: 34,166,291 V1025I possibly damaging Het
Dusp27 A T 1: 166,100,823 W407R probably benign Het
Elk3 T A 10: 93,265,677 I71F probably damaging Het
Flt3 A T 5: 147,369,490 I276N probably damaging Het
Frem1 G T 4: 82,913,558 T1988K probably benign Het
Gm597 A T 1: 28,778,153 V266D probably damaging Het
Golph3l T A 3: 95,617,357 D306E probably benign Het
Grk2 T A 19: 4,290,670 I254F probably damaging Het
Hgf C T 5: 16,576,921 T214I probably benign Het
Hoxc5 C A 15: 103,014,382 probably null Het
Hsd11b1 T C 1: 193,240,378 T124A probably benign Het
Ipp A G 4: 116,515,368 Y198C probably benign Het
Ism1 T A 2: 139,740,127 probably null Het
Klhl42 A G 6: 147,091,896 Y122C possibly damaging Het
Klk1b21 A T 7: 44,105,994 K206* probably null Het
Lcn11 A G 2: 25,778,085 K85R probably benign Het
Macf1 G T 4: 123,472,730 A2746E probably damaging Het
Matn4 A G 2: 164,400,653 V175A probably damaging Het
Myh2 A T 11: 67,191,719 N1372Y probably damaging Het
Ncl A G 1: 86,356,955 probably null Het
Nudt2 A G 4: 41,480,255 D46G probably damaging Het
Obscn C T 11: 59,067,174 D3567N probably benign Het
Olfr1245 A T 2: 89,574,961 M255K possibly damaging Het
Olfr346 G C 2: 36,688,475 V158L probably benign Het
Olfr373 G T 8: 72,100,086 V109F possibly damaging Het
Pamr1 T A 2: 102,634,535 M343K probably benign Het
Pcdh15 T G 10: 74,631,193 S1684A possibly damaging Het
Ppm1h T A 10: 122,878,528 L324* probably null Het
Ppp3r2 T C 4: 49,681,723 I76V probably benign Het
Prkdc G A 16: 15,677,009 V748I probably benign Het
Prss47 A G 13: 65,051,777 V96A probably benign Het
Rsbn1 C T 3: 103,914,473 T8I probably benign Het
Rsf1 GGCG GGCGACGGCGGCG 7: 97,579,906 probably benign Het
Serpinb3d A G 1: 107,078,452 V302A probably benign Het
Sfrp4 A T 13: 19,632,326 I177F probably benign Het
Sh3bp2 A G 5: 34,544,225 probably benign Het
Slc7a12 A G 3: 14,497,333 T257A probably damaging Het
Specc1l T C 10: 75,267,591 probably null Het
Tctex1d4 A G 4: 117,128,307 E109G possibly damaging Het
Tmem2 G A 19: 21,844,750 A1170T possibly damaging Het
Tmem30c T C 16: 57,281,362 T68A probably damaging Het
Tnr A G 1: 159,852,022 I189V probably benign Het
Trrap A G 5: 144,853,488 N3586S possibly damaging Het
Usp14 T C 18: 10,024,632 T22A probably damaging Het
Vmn1r68 A G 7: 10,527,991 L60P probably damaging Het
Vmn2r108 G A 17: 20,470,990 H424Y probably benign Het
Wdr81 C A 11: 75,445,962 E1534* probably null Het
Zc3h13 A G 14: 75,330,195 E976G probably damaging Het
Zfp128 T C 7: 12,890,029 L108P possibly damaging Het
Zfp644 T C 5: 106,635,682 I1000V possibly damaging Het
Other mutations in Stard9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01103:Stard9 APN 2 120701847 missense possibly damaging 0.52
IGL01122:Stard9 APN 2 120698479 missense possibly damaging 0.93
IGL01318:Stard9 APN 2 120698719 missense possibly damaging 0.56
IGL01371:Stard9 APN 2 120701368 missense probably benign 0.04
IGL01394:Stard9 APN 2 120706327 missense possibly damaging 0.78
IGL01531:Stard9 APN 2 120673604 missense possibly damaging 0.93
IGL01721:Stard9 APN 2 120703330 missense probably damaging 1.00
IGL01810:Stard9 APN 2 120699084 missense possibly damaging 0.95
IGL01829:Stard9 APN 2 120706446 missense possibly damaging 0.59
IGL01916:Stard9 APN 2 120668016 missense probably damaging 1.00
IGL02031:Stard9 APN 2 120702339 missense probably benign 0.27
IGL02081:Stard9 APN 2 120664910 missense probably damaging 0.98
IGL02558:Stard9 APN 2 120696907 missense possibly damaging 0.95
IGL02646:Stard9 APN 2 120698992 missense probably damaging 1.00
IGL02873:Stard9 APN 2 120713807 missense probably damaging 1.00
IGL03195:Stard9 APN 2 120705802 missense probably damaging 1.00
IGL03204:Stard9 APN 2 120705802 missense probably damaging 1.00
FR4737:Stard9 UTSW 2 120696085 small insertion probably benign
IGL03014:Stard9 UTSW 2 120702194 unclassified probably benign
R0027:Stard9 UTSW 2 120703501 missense probably benign
R0027:Stard9 UTSW 2 120703501 missense probably benign
R0038:Stard9 UTSW 2 120695832 missense probably benign
R0049:Stard9 UTSW 2 120699819 missense probably damaging 1.00
R0049:Stard9 UTSW 2 120699819 missense probably damaging 1.00
R0116:Stard9 UTSW 2 120634255 missense probably damaging 0.99
R0398:Stard9 UTSW 2 120696307 missense probably benign 0.03
R0479:Stard9 UTSW 2 120697596 missense probably damaging 1.00
R0556:Stard9 UTSW 2 120698923 missense probably benign 0.09
R0589:Stard9 UTSW 2 120698547 missense probably benign 0.00
R0609:Stard9 UTSW 2 120706306 missense probably damaging 1.00
R0611:Stard9 UTSW 2 120699257 missense probably benign 0.00
R0683:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R0751:Stard9 UTSW 2 120697485 missense probably benign 0.04
R0833:Stard9 UTSW 2 120696999 missense possibly damaging 0.86
R0836:Stard9 UTSW 2 120696999 missense possibly damaging 0.86
R0838:Stard9 UTSW 2 120700842 missense probably damaging 1.00
R0848:Stard9 UTSW 2 120695823 missense probably damaging 1.00
R0849:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R0961:Stard9 UTSW 2 120693439 missense probably benign 0.01
R0993:Stard9 UTSW 2 120705169 missense probably damaging 1.00
R1005:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R1006:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R1115:Stard9 UTSW 2 120692850 missense probably benign 0.05
R1163:Stard9 UTSW 2 120696213 missense possibly damaging 0.86
R1199:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R1200:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R1331:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R1332:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R1333:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R1334:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R1335:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R1336:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R1338:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R1346:Stard9 UTSW 2 120713448 missense probably damaging 1.00
R1370:Stard9 UTSW 2 120697477 missense probably benign 0.11
R1384:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R1401:Stard9 UTSW 2 120712847 splice site probably benign
R1416:Stard9 UTSW 2 120700972 missense probably benign 0.00
R1453:Stard9 UTSW 2 120666376 missense probably damaging 1.00
R1468:Stard9 UTSW 2 120703197 missense possibly damaging 0.90
R1468:Stard9 UTSW 2 120703197 missense possibly damaging 0.90
R1525:Stard9 UTSW 2 120702052 missense probably benign 0.09
R1538:Stard9 UTSW 2 120696711 missense probably benign 0.25
R1614:Stard9 UTSW 2 120697675 missense possibly damaging 0.95
R1654:Stard9 UTSW 2 120703722 missense probably benign 0.37
R1658:Stard9 UTSW 2 120701542 missense probably benign 0.02
R1686:Stard9 UTSW 2 120699492 missense probably benign 0.00
R1797:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R1803:Stard9 UTSW 2 120701489 missense probably benign 0.24
R1806:Stard9 UTSW 2 120679453 splice site probably null
R1847:Stard9 UTSW 2 120698489 missense possibly damaging 0.51
R1853:Stard9 UTSW 2 120688751 missense probably damaging 1.00
R1892:Stard9 UTSW 2 120693708 missense probably benign 0.01
R1906:Stard9 UTSW 2 120696427 missense probably benign 0.00
R1907:Stard9 UTSW 2 120713812 missense probably damaging 1.00
R1930:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R1933:Stard9 UTSW 2 120698656 missense possibly damaging 0.55
R1989:Stard9 UTSW 2 120701406 missense probably benign
R1999:Stard9 UTSW 2 120692868 missense probably damaging 0.99
R2004:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R2005:Stard9 UTSW 2 120664945 missense possibly damaging 0.90
R2005:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R2025:Stard9 UTSW 2 120702398 missense probably benign 0.20
R2190:Stard9 UTSW 2 120714120 missense probably benign 0.22
R2204:Stard9 UTSW 2 120698531 frame shift probably null
R2422:Stard9 UTSW 2 120700284 missense probably benign 0.29
R3401:Stard9 UTSW 2 120703689 missense probably damaging 0.98
R3618:Stard9 UTSW 2 120699019 missense possibly damaging 0.49
R3619:Stard9 UTSW 2 120699019 missense possibly damaging 0.49
R3900:Stard9 UTSW 2 120713549 missense possibly damaging 0.93
R3943:Stard9 UTSW 2 120698229 missense probably benign 0.11
R4022:Stard9 UTSW 2 120704155 missense probably benign 0.05
R4223:Stard9 UTSW 2 120664991 missense possibly damaging 0.95
R4224:Stard9 UTSW 2 120664991 missense possibly damaging 0.95
R4225:Stard9 UTSW 2 120664991 missense possibly damaging 0.95
R4345:Stard9 UTSW 2 120701946 missense probably benign 0.43
R4382:Stard9 UTSW 2 120634222 missense probably damaging 1.00
R4453:Stard9 UTSW 2 120697791 missense probably benign
R4499:Stard9 UTSW 2 120700241 missense probably benign 0.05
R4524:Stard9 UTSW 2 120696445 missense probably damaging 1.00
R4671:Stard9 UTSW 2 120698640 missense probably damaging 0.98
R4701:Stard9 UTSW 2 120705713 missense possibly damaging 0.85
R4744:Stard9 UTSW 2 120696123 missense probably benign 0.01
R4822:Stard9 UTSW 2 120695941 missense possibly damaging 0.94
R4847:Stard9 UTSW 2 120703113 missense probably benign 0.18
R4863:Stard9 UTSW 2 120700860 missense probably benign 0.00
R4898:Stard9 UTSW 2 120706419 nonsense probably null
R5033:Stard9 UTSW 2 120693399 missense probably benign 0.00
R5087:Stard9 UTSW 2 120697019 nonsense probably null
R5157:Stard9 UTSW 2 120697861 missense probably benign
R5213:Stard9 UTSW 2 120699226 missense probably damaging 1.00
R5237:Stard9 UTSW 2 120699358 missense probably damaging 0.96
R5257:Stard9 UTSW 2 120699343 missense probably damaging 0.99
R5258:Stard9 UTSW 2 120699343 missense probably damaging 0.99
R5273:Stard9 UTSW 2 120705087 missense possibly damaging 0.94
R5286:Stard9 UTSW 2 120701947 missense probably benign 0.43
R5288:Stard9 UTSW 2 120700630 missense probably damaging 0.98
R5292:Stard9 UTSW 2 120699145 missense probably benign 0.17
R5328:Stard9 UTSW 2 120699230 missense probably damaging 1.00
R5385:Stard9 UTSW 2 120700630 missense probably damaging 0.98
R5386:Stard9 UTSW 2 120700630 missense probably damaging 0.98
R5393:Stard9 UTSW 2 120702906 missense possibly damaging 0.87
R5405:Stard9 UTSW 2 120693668 missense probably benign 0.17
R5685:Stard9 UTSW 2 120705322 missense probably damaging 1.00
R5749:Stard9 UTSW 2 120703786 missense probably damaging 1.00
R5780:Stard9 UTSW 2 120703396 missense probably benign 0.02
R5901:Stard9 UTSW 2 120701370 missense probably damaging 1.00
R5941:Stard9 UTSW 2 120713558 missense probably damaging 1.00
R5960:Stard9 UTSW 2 120699961 missense probably benign 0.05
R5966:Stard9 UTSW 2 120697099 missense probably damaging 1.00
R5967:Stard9 UTSW 2 120706894 missense probably damaging 0.99
R6012:Stard9 UTSW 2 120704586 missense probably damaging 1.00
R6019:Stard9 UTSW 2 120693715 frame shift probably null
R6020:Stard9 UTSW 2 120693715 frame shift probably null
R6036:Stard9 UTSW 2 120700075 missense probably benign 0.09
R6036:Stard9 UTSW 2 120700075 missense probably benign 0.09
R6090:Stard9 UTSW 2 120693654 missense probably damaging 0.99
R6192:Stard9 UTSW 2 120696760 missense probably damaging 0.99
R6228:Stard9 UTSW 2 120713750 missense probably damaging 1.00
R6235:Stard9 UTSW 2 120713546 missense probably damaging 1.00
R6280:Stard9 UTSW 2 120701127 missense probably benign
R6338:Stard9 UTSW 2 120697485 missense probably benign
R6344:Stard9 UTSW 2 120704320 missense probably benign 0.12
R6364:Stard9 UTSW 2 120713429 missense probably damaging 1.00
R6383:Stard9 UTSW 2 120666407 critical splice donor site probably null
R6644:Stard9 UTSW 2 120695772 missense probably benign 0.11
R6747:Stard9 UTSW 2 120698383 missense possibly damaging 0.62
R6833:Stard9 UTSW 2 120701259 missense probably damaging 1.00
R6836:Stard9 UTSW 2 120699843 missense probably benign 0.15
R6861:Stard9 UTSW 2 120705186 missense probably benign 0.09
R6872:Stard9 UTSW 2 120714068 nonsense probably null
R6875:Stard9 UTSW 2 120697436 missense probably benign 0.04
R6915:Stard9 UTSW 2 120702630 missense probably benign 0.00
R6934:Stard9 UTSW 2 120697695 missense probably benign 0.00
R6943:Stard9 UTSW 2 120702196 missense probably benign 0.29
R7009:Stard9 UTSW 2 120697191 missense probably benign 0.37
R7031:Stard9 UTSW 2 120700450 missense possibly damaging 0.61
R7132:Stard9 UTSW 2 120679378 nonsense probably null
R7151:Stard9 UTSW 2 120696142 missense not run
X0023:Stard9 UTSW 2 120702744 missense probably benign 0.00
X0023:Stard9 UTSW 2 120702963 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- ATGGTTCTGCTTCGACCACC -3'
(R):5'- GGAGAATCTGGGCATGTTGAC -3'

Sequencing Primer
(F):5'- TTCGACCACCGTGGATGAG -3'
(R):5'- TGTTGACCACCATGCAAGATTC -3'
Posted On2014-08-25