Incidental Mutation 'R2021:Rsbn1'
ID223949
Institutional Source Beutler Lab
Gene Symbol Rsbn1
Ensembl Gene ENSMUSG00000044098
Gene Namerosbin, round spermatid basic protein 1
SynonymsC230004D03Rik, Rsbp
MMRRC Submission 040030-MU
Accession Numbers

Genbank: NM_172684; MGI: 2444993

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2021 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location103914120-103966636 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 103914473 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 8 (T8I)
Ref Sequence ENSEMBL: ENSMUSP00000069246 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029433] [ENSMUST00000051139] [ENSMUST00000068879] [ENSMUST00000146071]
Predicted Effect probably benign
Transcript: ENSMUST00000029433
SMART Domains Protein: ENSMUSP00000029433
Gene: ENSMUSG00000027843

DomainStartEndE-ValueType
low complexity region 7 19 N/A INTRINSIC
PTPc 23 291 3.32e-123 SMART
Blast:PTPc 305 502 2e-65 BLAST
PDB:1JEG|B 605 629 2e-8 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000051139
AA Change: T8I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000058934
Gene: ENSMUSG00000044098
AA Change: T8I

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
low complexity region 59 76 N/A INTRINSIC
low complexity region 84 109 N/A INTRINSIC
low complexity region 136 151 N/A INTRINSIC
low complexity region 205 214 N/A INTRINSIC
low complexity region 466 477 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000068879
AA Change: T8I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000069246
Gene: ENSMUSG00000044098
AA Change: T8I

DomainStartEndE-ValueType
low complexity region 21 36 N/A INTRINSIC
low complexity region 49 64 N/A INTRINSIC
low complexity region 106 123 N/A INTRINSIC
low complexity region 131 156 N/A INTRINSIC
low complexity region 183 198 N/A INTRINSIC
low complexity region 252 261 N/A INTRINSIC
low complexity region 513 524 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126548
Predicted Effect probably benign
Transcript: ENSMUST00000146071
SMART Domains Protein: ENSMUSP00000122307
Gene: ENSMUSG00000027843

DomainStartEndE-ValueType
low complexity region 7 19 N/A INTRINSIC
PTPc 23 291 3.32e-123 SMART
Blast:PTPc 305 502 9e-66 BLAST
internal_repeat_1 567 629 1.92e-7 PROSPERO
internal_repeat_1 651 705 1.92e-7 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000151927
SMART Domains Protein: ENSMUSP00000115693
Gene: ENSMUSG00000044098

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
low complexity region 59 76 N/A INTRINSIC
low complexity region 84 109 N/A INTRINSIC
low complexity region 136 151 N/A INTRINSIC
low complexity region 205 214 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency
Allele List at MGI

All alleles(9) : Targeted, other(3) Gene trapped(6)

Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik T C 6: 48,931,451 S462P probably damaging Het
Ablim1 A T 19: 57,047,018 S316T probably damaging Het
Alox8 C T 11: 69,186,288 V460I probably damaging Het
Arvcf G A 16: 18,399,732 A491T probably damaging Het
Asnsd1 A G 1: 53,347,227 S414P possibly damaging Het
Btbd7 A G 12: 102,790,709 L706P probably damaging Het
Camk2d T A 3: 126,780,456 W171R probably damaging Het
Casc3 T A 11: 98,821,506 S124T probably benign Het
Casp8ap2 T C 4: 32,644,560 V1211A probably benign Het
Ccdc182 T C 11: 88,294,136 V14A possibly damaging Het
Ccdc80 A T 16: 45,122,912 Q795L probably damaging Het
Ccdc88a T G 11: 29,503,480 S1614R probably damaging Het
Clcn6 A G 4: 148,010,652 probably null Het
Cubn A G 2: 13,308,549 V3070A probably benign Het
Dst G A 1: 34,166,291 V1025I possibly damaging Het
Dusp27 A T 1: 166,100,823 W407R probably benign Het
Elk3 T A 10: 93,265,677 I71F probably damaging Het
Flt3 A T 5: 147,369,490 I276N probably damaging Het
Frem1 G T 4: 82,913,558 T1988K probably benign Het
Gm597 A T 1: 28,778,153 V266D probably damaging Het
Golph3l T A 3: 95,617,357 D306E probably benign Het
Grk2 T A 19: 4,290,670 I254F probably damaging Het
Hgf C T 5: 16,576,921 T214I probably benign Het
Hoxc5 C A 15: 103,014,382 probably null Het
Hsd11b1 T C 1: 193,240,378 T124A probably benign Het
Ipp A G 4: 116,515,368 Y198C probably benign Het
Ism1 T A 2: 139,740,127 probably null Het
Klhl42 A G 6: 147,091,896 Y122C possibly damaging Het
Klk1b21 A T 7: 44,105,994 K206* probably null Het
Lcn11 A G 2: 25,778,085 K85R probably benign Het
Macf1 G T 4: 123,472,730 A2746E probably damaging Het
Matn4 A G 2: 164,400,653 V175A probably damaging Het
Myh2 A T 11: 67,191,719 N1372Y probably damaging Het
Ncl A G 1: 86,356,955 probably null Het
Nudt2 A G 4: 41,480,255 D46G probably damaging Het
Obscn C T 11: 59,067,174 D3567N probably benign Het
Olfr1245 A T 2: 89,574,961 M255K possibly damaging Het
Olfr346 G C 2: 36,688,475 V158L probably benign Het
Olfr373 G T 8: 72,100,086 V109F possibly damaging Het
Pamr1 T A 2: 102,634,535 M343K probably benign Het
Pcdh15 T G 10: 74,631,193 S1684A possibly damaging Het
Ppm1h T A 10: 122,878,528 L324* probably null Het
Ppp3r2 T C 4: 49,681,723 I76V probably benign Het
Prkdc G A 16: 15,677,009 V748I probably benign Het
Prss47 A G 13: 65,051,777 V96A probably benign Het
Rsf1 GGCG GGCGACGGCGGCG 7: 97,579,906 probably benign Het
Serpinb3d A G 1: 107,078,452 V302A probably benign Het
Sfrp4 A T 13: 19,632,326 I177F probably benign Het
Sh3bp2 A G 5: 34,544,225 probably benign Het
Slc7a12 A G 3: 14,497,333 T257A probably damaging Het
Specc1l T C 10: 75,267,591 probably null Het
Stard9 A G 2: 120,704,235 T3658A probably benign Het
Tctex1d4 A G 4: 117,128,307 E109G possibly damaging Het
Tmem2 G A 19: 21,844,750 A1170T possibly damaging Het
Tmem30c T C 16: 57,281,362 T68A probably damaging Het
Tnr A G 1: 159,852,022 I189V probably benign Het
Trrap A G 5: 144,853,488 N3586S possibly damaging Het
Usp14 T C 18: 10,024,632 T22A probably damaging Het
Vmn1r68 A G 7: 10,527,991 L60P probably damaging Het
Vmn2r108 G A 17: 20,470,990 H424Y probably benign Het
Wdr81 C A 11: 75,445,962 E1534* probably null Het
Zc3h13 A G 14: 75,330,195 E976G probably damaging Het
Zfp128 T C 7: 12,890,029 L108P possibly damaging Het
Zfp644 T C 5: 106,635,682 I1000V possibly damaging Het
Other mutations in Rsbn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00595:Rsbn1 APN 3 103928690 missense probably benign 0.01
IGL00725:Rsbn1 APN 3 103928821 missense probably damaging 0.96
IGL01682:Rsbn1 APN 3 103962380 missense probably benign 0.03
IGL01978:Rsbn1 APN 3 103961500 missense probably damaging 0.99
IGL02281:Rsbn1 APN 3 103962461 missense probably damaging 0.99
IGL02615:Rsbn1 APN 3 103953752 missense probably damaging 1.00
IGL02902:Rsbn1 APN 3 103953656 missense possibly damaging 0.62
IGL02903:Rsbn1 APN 3 103928569 missense probably damaging 1.00
IGL02927:Rsbn1 APN 3 103962352 missense probably benign
IGL03007:Rsbn1 APN 3 103928879 missense probably damaging 1.00
IGL03062:Rsbn1 APN 3 103953629 intron probably benign
IGL03345:Rsbn1 APN 3 103915150 missense possibly damaging 0.78
F2404:Rsbn1 UTSW 3 103914576 nonsense probably null
R0277:Rsbn1 UTSW 3 103914581 missense possibly damaging 0.66
R0815:Rsbn1 UTSW 3 103954153 missense probably damaging 0.98
R1760:Rsbn1 UTSW 3 103960031 missense probably damaging 1.00
R1801:Rsbn1 UTSW 3 103914872 missense probably damaging 0.97
R2078:Rsbn1 UTSW 3 103961523 missense probably damaging 1.00
R2330:Rsbn1 UTSW 3 103914500 missense probably damaging 0.97
R3956:Rsbn1 UTSW 3 103928675 missense probably damaging 0.99
R4094:Rsbn1 UTSW 3 103928658 missense probably damaging 0.98
R4649:Rsbn1 UTSW 3 103953780 splice site probably null
R4720:Rsbn1 UTSW 3 103929020 missense possibly damaging 0.92
R5299:Rsbn1 UTSW 3 103914490 missense probably benign 0.01
R5505:Rsbn1 UTSW 3 103928943 missense probably damaging 1.00
R5699:Rsbn1 UTSW 3 103962485 missense probably benign 0.02
R5775:Rsbn1 UTSW 3 103962572 missense possibly damaging 0.80
R6509:Rsbn1 UTSW 3 103960032 missense probably damaging 1.00
R6629:Rsbn1 UTSW 3 103928441 missense probably damaging 1.00
R7070:Rsbn1 UTSW 3 103928983 missense probably damaging 1.00
R7116:Rsbn1 UTSW 3 103914576 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACACGGCGAGACTCTGAAAG -3'
(R):5'- AACATGGGGTTTCTCCTTCC -3'

Sequencing Primer
(F):5'- CGGCGAGACTCTGAAAGCTATTAAC -3'
(R):5'- ATGGGGTTTCTCCTTCCCTTCTTTG -3'
Posted On2014-08-25