Incidental Mutation 'R2021:Ppp3r2'
ID223958
Institutional Source Beutler Lab
Gene Symbol Ppp3r2
Ensembl Gene ENSMUSG00000028310
Gene Nameprotein phosphatase 3, regulatory subunit B, alpha isoform (calcineurin B, type II)
SynonymsCnB2, CaNB2, PP2B beta 2
MMRRC Submission 040030-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.131) question?
Stock #R2021 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location49678747-49682024 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 49681723 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 76 (I76V)
Ref Sequence ENSEMBL: ENSMUSP00000029991 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029991] [ENSMUST00000076674] [ENSMUST00000093859]
Predicted Effect probably benign
Transcript: ENSMUST00000029991
AA Change: I76V

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000029991
Gene: ENSMUSG00000028310
AA Change: I76V

DomainStartEndE-ValueType
EFh 22 50 1.72e0 SMART
EFh 54 82 2.37e-3 SMART
EFh 91 119 4.19e-4 SMART
EFh 132 160 1.73e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000076674
SMART Domains Protein: ENSMUSP00000075970
Gene: ENSMUSG00000039579

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
low complexity region 161 181 N/A INTRINSIC
Lig_chan-Glu_bd 557 622 9.62e-22 SMART
PBPe 565 910 1.43e-73 SMART
transmembrane domain 934 956 N/A INTRINSIC
coiled coil region 1063 1105 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000093859
SMART Domains Protein: ENSMUSP00000091381
Gene: ENSMUSG00000039579

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
low complexity region 161 181 N/A INTRINSIC
Lig_chan-Glu_bd 557 622 9.62e-22 SMART
PBPe 565 910 1.43e-73 SMART
transmembrane domain 934 956 N/A INTRINSIC
coiled coil region 1083 1125 N/A INTRINSIC
Meta Mutation Damage Score 0.054 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit male infertility due to reduced hyperactivated sperm motility and midpiece rigidity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik T C 6: 48,931,451 S462P probably damaging Het
Ablim1 A T 19: 57,047,018 S316T probably damaging Het
Alox8 C T 11: 69,186,288 V460I probably damaging Het
Arvcf G A 16: 18,399,732 A491T probably damaging Het
Asnsd1 A G 1: 53,347,227 S414P possibly damaging Het
Btbd7 A G 12: 102,790,709 L706P probably damaging Het
Camk2d T A 3: 126,780,456 W171R probably damaging Het
Casc3 T A 11: 98,821,506 S124T probably benign Het
Casp8ap2 T C 4: 32,644,560 V1211A probably benign Het
Ccdc182 T C 11: 88,294,136 V14A possibly damaging Het
Ccdc80 A T 16: 45,122,912 Q795L probably damaging Het
Ccdc88a T G 11: 29,503,480 S1614R probably damaging Het
Clcn6 A G 4: 148,010,652 probably null Het
Cubn A G 2: 13,308,549 V3070A probably benign Het
Dst G A 1: 34,166,291 V1025I possibly damaging Het
Dusp27 A T 1: 166,100,823 W407R probably benign Het
Elk3 T A 10: 93,265,677 I71F probably damaging Het
Flt3 A T 5: 147,369,490 I276N probably damaging Het
Frem1 G T 4: 82,913,558 T1988K probably benign Het
Gm597 A T 1: 28,778,153 V266D probably damaging Het
Golph3l T A 3: 95,617,357 D306E probably benign Het
Grk2 T A 19: 4,290,670 I254F probably damaging Het
Hgf C T 5: 16,576,921 T214I probably benign Het
Hoxc5 C A 15: 103,014,382 probably null Het
Hsd11b1 T C 1: 193,240,378 T124A probably benign Het
Ipp A G 4: 116,515,368 Y198C probably benign Het
Ism1 T A 2: 139,740,127 probably null Het
Klhl42 A G 6: 147,091,896 Y122C possibly damaging Het
Klk1b21 A T 7: 44,105,994 K206* probably null Het
Lcn11 A G 2: 25,778,085 K85R probably benign Het
Macf1 G T 4: 123,472,730 A2746E probably damaging Het
Matn4 A G 2: 164,400,653 V175A probably damaging Het
Myh2 A T 11: 67,191,719 N1372Y probably damaging Het
Ncl A G 1: 86,356,955 probably null Het
Nudt2 A G 4: 41,480,255 D46G probably damaging Het
Obscn C T 11: 59,067,174 D3567N probably benign Het
Olfr1245 A T 2: 89,574,961 M255K possibly damaging Het
Olfr346 G C 2: 36,688,475 V158L probably benign Het
Olfr373 G T 8: 72,100,086 V109F possibly damaging Het
Pamr1 T A 2: 102,634,535 M343K probably benign Het
Pcdh15 T G 10: 74,631,193 S1684A possibly damaging Het
Ppm1h T A 10: 122,878,528 L324* probably null Het
Prkdc G A 16: 15,677,009 V748I probably benign Het
Prss47 A G 13: 65,051,777 V96A probably benign Het
Rsbn1 C T 3: 103,914,473 T8I probably benign Het
Rsf1 GGCG GGCGACGGCGGCG 7: 97,579,906 probably benign Het
Serpinb3d A G 1: 107,078,452 V302A probably benign Het
Sfrp4 A T 13: 19,632,326 I177F probably benign Het
Sh3bp2 A G 5: 34,544,225 probably benign Het
Slc7a12 A G 3: 14,497,333 T257A probably damaging Het
Specc1l T C 10: 75,267,591 probably null Het
Stard9 A G 2: 120,704,235 T3658A probably benign Het
Tctex1d4 A G 4: 117,128,307 E109G possibly damaging Het
Tmem2 G A 19: 21,844,750 A1170T possibly damaging Het
Tmem30c T C 16: 57,281,362 T68A probably damaging Het
Tnr A G 1: 159,852,022 I189V probably benign Het
Trrap A G 5: 144,853,488 N3586S possibly damaging Het
Usp14 T C 18: 10,024,632 T22A probably damaging Het
Vmn1r68 A G 7: 10,527,991 L60P probably damaging Het
Vmn2r108 G A 17: 20,470,990 H424Y probably benign Het
Wdr81 C A 11: 75,445,962 E1534* probably null Het
Zc3h13 A G 14: 75,330,195 E976G probably damaging Het
Zfp128 T C 7: 12,890,029 L108P possibly damaging Het
Zfp644 T C 5: 106,635,682 I1000V possibly damaging Het
Other mutations in Ppp3r2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00496:Ppp3r2 APN 4 49681773 missense possibly damaging 0.84
IGL03371:Ppp3r2 APN 4 49681630 missense probably damaging 1.00
R0365:Ppp3r2 UTSW 4 49681902 missense possibly damaging 0.77
R0928:Ppp3r2 UTSW 4 49681439 critical splice donor site probably null
R1957:Ppp3r2 UTSW 4 49681726 missense probably damaging 1.00
R2022:Ppp3r2 UTSW 4 49681723 missense probably benign 0.02
R2023:Ppp3r2 UTSW 4 49681723 missense probably benign 0.02
R6102:Ppp3r2 UTSW 4 49682022 intron probably benign
R6385:Ppp3r2 UTSW 4 49681767 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- AAGATGCTCTTGTCCACCAGC -3'
(R):5'- AGGCCAGCTACCAAACTGAG -3'

Sequencing Primer
(F):5'- TGTCCACCAGCTGCTGCAG -3'
(R):5'- GCTACCAAACTGAGCTGTGC -3'
Posted On2014-08-25