Incidental Mutation 'R0142:Ercc6l2'
ID22403
Institutional Source Beutler Lab
Gene Symbol Ercc6l2
Ensembl Gene ENSMUSG00000021470
Gene Nameexcision repair cross-complementing rodent repair deficiency, complementation group 6 like 2
Synonyms0610007P08Rik, 1700019D06Rik, 9330134C04Rik
MMRRC Submission 038427-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.548) question?
Stock #R0142 (G1)
Quality Score225
Status Validated (trace)
Chromosome13
Chromosomal Location63815240-63900302 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to C at 63872506 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000124912 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067821] [ENSMUST00000095724] [ENSMUST00000159957]
Predicted Effect probably benign
Transcript: ENSMUST00000067821
SMART Domains Protein: ENSMUSP00000069488
Gene: ENSMUSG00000021470

DomainStartEndE-ValueType
DEXDc 118 331 1.94e-33 SMART
Blast:DEXDc 380 425 3e-13 BLAST
HELICc 536 619 3.12e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000095724
SMART Domains Protein: ENSMUSP00000093392
Gene: ENSMUSG00000021470

DomainStartEndE-ValueType
DEXDc 1 183 2.72e-14 SMART
Blast:DEXDc 232 277 3e-13 BLAST
HELICc 388 471 3.12e-23 SMART
low complexity region 817 827 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000109776
Predicted Effect probably benign
Transcript: ENSMUST00000159957
SMART Domains Protein: ENSMUSP00000124912
Gene: ENSMUSG00000021470

DomainStartEndE-ValueType
Pfam:SNF2_N 101 195 2.1e-8 PFAM
Predicted Effect
Meta Mutation Damage Score 0.0232 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.0%
  • 20x: 87.6%
Validation Efficiency 92% (61/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Snf2 family of helicase-like proteins. The encoded protein may play a role in DNA repair and mitochondrial function. Mutations in this gene have been associated with bone marrow failure syndrome 2. Alternatively spliced transcript variants that encode different protein isoforms have been described. [provided by RefSeq, Apr 2014]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik A G 19: 29,718,254 S1347P possibly damaging Het
Abca6 T G 11: 110,188,641 D1229A probably damaging Het
Abhd8 A C 8: 71,461,862 F41V probably damaging Het
Ago4 T G 4: 126,516,932 E222A probably benign Het
Ap3b2 T C 7: 81,473,080 I470V probably damaging Het
Bcl9l C T 9: 44,507,112 T749M probably benign Het
Bicc1 T C 10: 70,925,370 K937E probably damaging Het
Bmi1 G A 2: 18,683,284 probably null Het
Boc A C 16: 44,490,241 I772S probably damaging Het
C2 T A 17: 34,873,528 I178F possibly damaging Het
Cacna1c G T 6: 118,603,882 A1416E probably damaging Het
Chst10 A G 1: 38,871,729 L118P probably damaging Het
Crybg1 G A 10: 43,999,063 T683I possibly damaging Het
Cul5 C T 9: 53,635,050 V314I probably damaging Het
Dnajc17 C A 2: 119,179,934 R211I probably benign Het
Emilin1 A G 5: 30,913,920 T16A probably benign Het
Fsd2 T A 7: 81,559,935 D53V probably damaging Het
Galnt13 A G 2: 55,098,603 D479G probably damaging Het
Grk3 A T 5: 112,915,053 W643R probably damaging Het
Hdgf G A 3: 87,913,109 A4T possibly damaging Het
Hnrnpr T A 4: 136,327,282 V182E probably damaging Het
Ipo13 A C 4: 117,905,569 L279R probably damaging Het
Itga9 C A 9: 118,636,586 N169K probably damaging Het
Jph3 A G 8: 121,753,371 T263A possibly damaging Het
Jph4 G T 14: 55,108,326 Q625K probably benign Het
Kctd3 A C 1: 188,996,398 probably null Het
Kif26b A T 1: 178,915,389 S570C probably damaging Het
Klhl5 G A 5: 65,143,350 W164* probably null Het
Lacc1 A T 14: 77,030,799 H357Q probably benign Het
Lama2 A G 10: 27,187,845 I1316T probably benign Het
Lcp2 C T 11: 34,082,418 P332L probably damaging Het
Map3k6 A T 4: 133,250,946 H1033L probably benign Het
Mfsd2b A G 12: 4,866,234 V252A probably benign Het
Myo16 T A 8: 10,569,790 I1447N probably benign Het
Myo19 G A 11: 84,894,603 R224H probably damaging Het
Myo5a C T 9: 75,160,574 H637Y probably benign Het
Nek10 C T 14: 14,861,560 R539C possibly damaging Het
Nfix A T 8: 84,721,686 V404E probably damaging Het
Nr1i2 T C 16: 38,253,006 R203G probably benign Het
Nup210l G A 3: 90,172,113 G968D probably damaging Het
Olfr1494 A T 19: 13,749,255 I50F probably benign Het
Olfr697 G T 7: 106,741,765 H56Q probably benign Het
Olfr884 A T 9: 38,048,110 H296L probably benign Het
Phlpp2 C T 8: 109,907,513 R242W probably damaging Het
Plcz1 A G 6: 140,007,697 F398S probably damaging Het
Ppfibp2 C A 7: 107,744,177 P808T probably damaging Het
Srpk2 T C 5: 23,527,930 K239E probably damaging Het
Svep1 A G 4: 58,118,232 V830A probably benign Het
Tesc A T 5: 118,056,570 I149F possibly damaging Het
Thsd7a A G 6: 12,418,335 W632R probably damaging Het
Tmprss9 A G 10: 80,894,378 D704G possibly damaging Het
Tob1 T C 11: 94,214,597 Y320H probably damaging Het
Trpm3 G T 19: 22,987,916 D1582Y probably damaging Het
Ttc28 A G 5: 111,277,457 K1716R probably benign Het
Uqcrfs1 A G 13: 30,540,942 V205A probably benign Het
Usp29 G A 7: 6,962,335 M392I probably benign Het
Uspl1 A T 5: 149,188,349 Y22F possibly damaging Het
Virma C A 4: 11,548,783 N1780K probably benign Het
Vmn1r56 C T 7: 5,196,373 A82T probably benign Het
Vmn2r5 A T 3: 64,492,588 C553S probably damaging Het
Vwce A T 19: 10,664,612 R901W probably damaging Het
Wdpcp C A 11: 21,857,444 probably null Het
Zfp423 A T 8: 87,780,340 C1000* probably null Het
Zscan20 A G 4: 128,585,837 F954L probably benign Het
Other mutations in Ercc6l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00430:Ercc6l2 APN 13 63858319 missense probably damaging 0.99
IGL00678:Ercc6l2 APN 13 63844613 missense probably damaging 1.00
IGL00765:Ercc6l2 APN 13 63848772 missense possibly damaging 0.95
IGL01062:Ercc6l2 APN 13 63847454 missense probably null 1.00
IGL01655:Ercc6l2 APN 13 63819752 nonsense probably null
IGL02175:Ercc6l2 APN 13 63869190 utr 3 prime probably benign
IGL02201:Ercc6l2 APN 13 63852969 missense probably benign 0.12
IGL02351:Ercc6l2 APN 13 63853683 missense probably damaging 1.00
IGL02358:Ercc6l2 APN 13 63853683 missense probably damaging 1.00
IGL02622:Ercc6l2 APN 13 63853623 unclassified probably null
PIT4812001:Ercc6l2 UTSW 13 63858257 missense possibly damaging 0.58
R0648:Ercc6l2 UTSW 13 63844645 missense probably benign 0.04
R1136:Ercc6l2 UTSW 13 63869120 missense possibly damaging 0.75
R1536:Ercc6l2 UTSW 13 63824871 missense possibly damaging 0.81
R1706:Ercc6l2 UTSW 13 63872458 unclassified probably benign
R2108:Ercc6l2 UTSW 13 63871988 unclassified probably benign
R2111:Ercc6l2 UTSW 13 63834749 missense probably damaging 1.00
R2126:Ercc6l2 UTSW 13 63848771 missense probably damaging 1.00
R2154:Ercc6l2 UTSW 13 63866007 missense probably damaging 1.00
R3551:Ercc6l2 UTSW 13 63844595 missense probably damaging 1.00
R3773:Ercc6l2 UTSW 13 63841450 missense probably damaging 1.00
R3923:Ercc6l2 UTSW 13 63870735 unclassified probably benign
R4233:Ercc6l2 UTSW 13 63872168 unclassified probably benign
R4782:Ercc6l2 UTSW 13 63834738 missense probably damaging 1.00
R4928:Ercc6l2 UTSW 13 63894813 utr 3 prime probably benign
R5163:Ercc6l2 UTSW 13 63899031 utr 3 prime probably benign
R5268:Ercc6l2 UTSW 13 63869111 missense possibly damaging 0.92
R5423:Ercc6l2 UTSW 13 63872258 unclassified probably benign
R6128:Ercc6l2 UTSW 13 63853749 missense probably damaging 0.98
R6164:Ercc6l2 UTSW 13 63872344 unclassified probably benign
R7238:Ercc6l2 UTSW 13 63865984 missense probably damaging 0.98
R7295:Ercc6l2 UTSW 13 63819775 missense probably damaging 0.96
Z1088:Ercc6l2 UTSW 13 63853728 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- TGGACATCATTGCATGGGACAGGG -3'
(R):5'- AACCTGAGAGCTACGGTCTCCATC -3'

Sequencing Primer
(F):5'- GTATCCCACTCAGAGAATCCCTAAG -3'
(R):5'- GCTTCCTTTGCTGTTACAGG -3'
Posted On2013-04-16