Incidental Mutation 'R2021:Ablim1'
ID224056
Institutional Source Beutler Lab
Gene Symbol Ablim1
Ensembl Gene ENSMUSG00000025085
Gene Nameactin-binding LIM protein 1
Synonyms2210411C18Rik, abLIM-L, abLIM-M, 4833406P10Rik, abLIM-S, 9330196J19Rik, 2610209L21Rik, Limab1
MMRRC Submission 040030-MU
Accession Numbers

Genbank: NM_178688; MGI: 1194500

Is this an essential gene? Possibly non essential (E-score: 0.423) question?
Stock #R2021 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location57032733-57314919 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 57047018 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 316 (S316T)
Ref Sequence ENSEMBL: ENSMUSP00000127818 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079360] [ENSMUST00000099294] [ENSMUST00000104902] [ENSMUST00000111526] [ENSMUST00000111528] [ENSMUST00000111529] [ENSMUST00000111544] [ENSMUST00000111546] [ENSMUST00000111550] [ENSMUST00000111555] [ENSMUST00000111558] [ENSMUST00000111559]
Predicted Effect probably damaging
Transcript: ENSMUST00000079360
AA Change: S632T

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000078336
Gene: ENSMUSG00000025085
AA Change: S632T

DomainStartEndE-ValueType
low complexity region 3 16 N/A INTRINSIC
LIM 98 149 1.14e-9 SMART
LIM 157 209 1.37e-12 SMART
LIM 225 276 1.12e-17 SMART
LIM 284 336 5.87e-12 SMART
Pfam:AbLIM_anchor 393 825 1.9e-139 PFAM
VHP 826 861 1.22e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000099294
SMART Domains Protein: ENSMUSP00000096897
Gene: ENSMUSG00000025085

DomainStartEndE-ValueType
LIM 22 73 1.14e-9 SMART
LIM 81 133 1.37e-12 SMART
LIM 149 200 1.12e-17 SMART
LIM 208 260 5.87e-12 SMART
low complexity region 284 293 N/A INTRINSIC
coiled coil region 467 491 N/A INTRINSIC
low complexity region 516 531 N/A INTRINSIC
VHP 619 654 1.22e-17 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000104902
AA Change: S316T

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000127818
Gene: ENSMUSG00000025085
AA Change: S316T

DomainStartEndE-ValueType
Blast:LIM 1 20 3e-7 BLAST
PDB:1WIG|A 1 28 1e-8 PDB
low complexity region 88 97 N/A INTRINSIC
low complexity region 219 235 N/A INTRINSIC
coiled coil region 358 382 N/A INTRINSIC
low complexity region 407 422 N/A INTRINSIC
VHP 510 545 1.22e-17 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000111526
AA Change: S171T

PolyPhen 2 Score 0.801 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000107151
Gene: ENSMUSG00000025085
AA Change: S171T

DomainStartEndE-ValueType
Blast:LIM 1 20 2e-7 BLAST
PDB:1WIG|A 1 28 6e-9 PDB
coiled coil region 213 237 N/A INTRINSIC
low complexity region 262 277 N/A INTRINSIC
VHP 365 400 1.22e-17 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000111528
AA Change: S225T

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000107153
Gene: ENSMUSG00000025085
AA Change: S225T

DomainStartEndE-ValueType
Blast:LIM 1 20 3e-7 BLAST
PDB:1WIG|A 1 28 8e-9 PDB
low complexity region 72 81 N/A INTRINSIC
coiled coil region 267 291 N/A INTRINSIC
low complexity region 316 331 N/A INTRINSIC
VHP 419 454 1.22e-17 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000111529
AA Change: S197T

PolyPhen 2 Score 0.801 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000107154
Gene: ENSMUSG00000025085
AA Change: S197T

DomainStartEndE-ValueType
Blast:LIM 1 20 3e-7 BLAST
PDB:1WIG|A 1 28 8e-9 PDB
low complexity region 44 53 N/A INTRINSIC
coiled coil region 239 263 N/A INTRINSIC
low complexity region 288 303 N/A INTRINSIC
VHP 391 426 1.22e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111544
AA Change: S439T

PolyPhen 2 Score 0.091 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000107169
Gene: ENSMUSG00000025085
AA Change: S439T

DomainStartEndE-ValueType
LIM 22 73 1.14e-9 SMART
LIM 81 133 1.37e-12 SMART
LIM 149 200 1.12e-17 SMART
LIM 208 260 5.87e-12 SMART
low complexity region 284 293 N/A INTRINSIC
low complexity region 422 427 N/A INTRINSIC
coiled coil region 481 505 N/A INTRINSIC
low complexity region 530 545 N/A INTRINSIC
VHP 633 668 1.22e-17 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000111546
AA Change: S472T

PolyPhen 2 Score 0.934 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000107172
Gene: ENSMUSG00000025085
AA Change: S472T

DomainStartEndE-ValueType
LIM 22 73 5.7e-12 SMART
LIM 81 133 6.6e-15 SMART
LIM 149 200 5.4e-20 SMART
LIM 208 260 2.8e-14 SMART
low complexity region 284 293 N/A INTRINSIC
coiled coil region 514 538 N/A INTRINSIC
low complexity region 563 578 N/A INTRINSIC
VHP 666 700 1.2e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111550
SMART Domains Protein: ENSMUSP00000107175
Gene: ENSMUSG00000025085

DomainStartEndE-ValueType
LIM 22 73 1.14e-9 SMART
LIM 81 133 1.37e-12 SMART
LIM 149 200 1.12e-17 SMART
LIM 208 260 5.87e-12 SMART
low complexity region 312 321 N/A INTRINSIC
coiled coil region 495 519 N/A INTRINSIC
low complexity region 544 559 N/A INTRINSIC
VHP 647 682 1.22e-17 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000111555
AA Change: S548T

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000107180
Gene: ENSMUSG00000025085
AA Change: S548T

DomainStartEndE-ValueType
low complexity region 3 16 N/A INTRINSIC
LIM 98 149 1.14e-9 SMART
LIM 157 209 1.37e-12 SMART
LIM 225 276 1.12e-17 SMART
LIM 284 336 5.87e-12 SMART
low complexity region 360 369 N/A INTRINSIC
coiled coil region 590 614 N/A INTRINSIC
low complexity region 639 654 N/A INTRINSIC
VHP 742 777 1.22e-17 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000111558
AA Change: S515T

PolyPhen 2 Score 0.940 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000107183
Gene: ENSMUSG00000025085
AA Change: S515T

DomainStartEndE-ValueType
LIM 35 86 1.14e-9 SMART
LIM 94 146 1.37e-12 SMART
LIM 162 213 1.12e-17 SMART
LIM 221 273 5.87e-12 SMART
low complexity region 325 334 N/A INTRINSIC
low complexity region 498 503 N/A INTRINSIC
coiled coil region 557 581 N/A INTRINSIC
low complexity region 606 621 N/A INTRINSIC
VHP 709 744 1.22e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111559
AA Change: S485T

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000107184
Gene: ENSMUSG00000025085
AA Change: S485T

DomainStartEndE-ValueType
LIM 35 86 1.14e-9 SMART
LIM 94 146 1.37e-12 SMART
LIM 162 213 1.12e-17 SMART
LIM 221 273 5.87e-12 SMART
low complexity region 297 306 N/A INTRINSIC
coiled coil region 527 551 N/A INTRINSIC
low complexity region 576 591 N/A INTRINSIC
VHP 679 714 1.22e-17 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127198
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137389
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156316
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoskeletal LIM protein that binds to actin filaments via a domain that is homologous to erythrocyte dematin. LIM domains, found in over 60 proteins, play key roles in the regulation of developmental pathways. LIM domains also function as protein-binding interfaces, mediating specific protein-protein interactions. The protein encoded by this gene could mediate such interactions between actin filaments and cytoplasmic targets. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutant mice lacking the retina-specific isoform are healthy, fertile, and show no defects in retinal development or retinofugal projections. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted, knock-out(1) Targeted, other(1) Gene trapped(4)

Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik T C 6: 48,931,451 S462P probably damaging Het
Alox8 C T 11: 69,186,288 V460I probably damaging Het
Arvcf G A 16: 18,399,732 A491T probably damaging Het
Asnsd1 A G 1: 53,347,227 S414P possibly damaging Het
Btbd7 A G 12: 102,790,709 L706P probably damaging Het
Camk2d T A 3: 126,780,456 W171R probably damaging Het
Casc3 T A 11: 98,821,506 S124T probably benign Het
Casp8ap2 T C 4: 32,644,560 V1211A probably benign Het
Ccdc182 T C 11: 88,294,136 V14A possibly damaging Het
Ccdc80 A T 16: 45,122,912 Q795L probably damaging Het
Ccdc88a T G 11: 29,503,480 S1614R probably damaging Het
Clcn6 A G 4: 148,010,652 probably null Het
Cubn A G 2: 13,308,549 V3070A probably benign Het
Dst G A 1: 34,166,291 V1025I possibly damaging Het
Dusp27 A T 1: 166,100,823 W407R probably benign Het
Elk3 T A 10: 93,265,677 I71F probably damaging Het
Flt3 A T 5: 147,369,490 I276N probably damaging Het
Frem1 G T 4: 82,913,558 T1988K probably benign Het
Gm597 A T 1: 28,778,153 V266D probably damaging Het
Golph3l T A 3: 95,617,357 D306E probably benign Het
Grk2 T A 19: 4,290,670 I254F probably damaging Het
Hgf C T 5: 16,576,921 T214I probably benign Het
Hoxc5 C A 15: 103,014,382 probably null Het
Hsd11b1 T C 1: 193,240,378 T124A probably benign Het
Ipp A G 4: 116,515,368 Y198C probably benign Het
Ism1 T A 2: 139,740,127 probably null Het
Klhl42 A G 6: 147,091,896 Y122C possibly damaging Het
Klk1b21 A T 7: 44,105,994 K206* probably null Het
Lcn11 A G 2: 25,778,085 K85R probably benign Het
Macf1 G T 4: 123,472,730 A2746E probably damaging Het
Matn4 A G 2: 164,400,653 V175A probably damaging Het
Myh2 A T 11: 67,191,719 N1372Y probably damaging Het
Ncl A G 1: 86,356,955 probably null Het
Nudt2 A G 4: 41,480,255 D46G probably damaging Het
Obscn C T 11: 59,067,174 D3567N probably benign Het
Olfr1245 A T 2: 89,574,961 M255K possibly damaging Het
Olfr346 G C 2: 36,688,475 V158L probably benign Het
Olfr373 G T 8: 72,100,086 V109F possibly damaging Het
Pamr1 T A 2: 102,634,535 M343K probably benign Het
Pcdh15 T G 10: 74,631,193 S1684A possibly damaging Het
Ppm1h T A 10: 122,878,528 L324* probably null Het
Ppp3r2 T C 4: 49,681,723 I76V probably benign Het
Prkdc G A 16: 15,677,009 V748I probably benign Het
Prss47 A G 13: 65,051,777 V96A probably benign Het
Rsbn1 C T 3: 103,914,473 T8I probably benign Het
Rsf1 GGCG GGCGACGGCGGCG 7: 97,579,906 probably benign Het
Serpinb3d A G 1: 107,078,452 V302A probably benign Het
Sfrp4 A T 13: 19,632,326 I177F probably benign Het
Sh3bp2 A G 5: 34,544,225 probably benign Het
Slc7a12 A G 3: 14,497,333 T257A probably damaging Het
Specc1l T C 10: 75,267,591 probably null Het
Stard9 A G 2: 120,704,235 T3658A probably benign Het
Tctex1d4 A G 4: 117,128,307 E109G possibly damaging Het
Tmem2 G A 19: 21,844,750 A1170T possibly damaging Het
Tmem30c T C 16: 57,281,362 T68A probably damaging Het
Tnr A G 1: 159,852,022 I189V probably benign Het
Trrap A G 5: 144,853,488 N3586S possibly damaging Het
Usp14 T C 18: 10,024,632 T22A probably damaging Het
Vmn1r68 A G 7: 10,527,991 L60P probably damaging Het
Vmn2r108 G A 17: 20,470,990 H424Y probably benign Het
Wdr81 C A 11: 75,445,962 E1534* probably null Het
Zc3h13 A G 14: 75,330,195 E976G probably damaging Het
Zfp128 T C 7: 12,890,029 L108P possibly damaging Het
Zfp644 T C 5: 106,635,682 I1000V possibly damaging Het
Other mutations in Ablim1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00422:Ablim1 APN 19 57068186 missense probably damaging 1.00
IGL00466:Ablim1 APN 19 57068186 missense probably damaging 1.00
IGL00478:Ablim1 APN 19 57068186 missense probably damaging 1.00
IGL00847:Ablim1 APN 19 57152290 missense possibly damaging 0.59
IGL01063:Ablim1 APN 19 57061328 missense probably damaging 1.00
IGL01304:Ablim1 APN 19 57215721 missense probably benign
IGL01385:Ablim1 APN 19 57068914 missense probably damaging 1.00
IGL01707:Ablim1 APN 19 57039447 missense probably damaging 1.00
IGL02386:Ablim1 APN 19 57134654 missense probably damaging 1.00
IGL02427:Ablim1 APN 19 57079880 splice site probably benign
IGL02498:Ablim1 APN 19 57152319 nonsense probably null
A9681:Ablim1 UTSW 19 57173323 critical splice donor site probably null
R0089:Ablim1 UTSW 19 57043031 missense probably damaging 1.00
R0226:Ablim1 UTSW 19 57043870 missense probably damaging 1.00
R1419:Ablim1 UTSW 19 57134633 missense probably damaging 1.00
R1473:Ablim1 UTSW 19 57068236 missense probably damaging 1.00
R1587:Ablim1 UTSW 19 57083547 start codon destroyed probably null 0.99
R1588:Ablim1 UTSW 19 57083547 start codon destroyed probably null 0.99
R1935:Ablim1 UTSW 19 57215965 start gained probably null
R1936:Ablim1 UTSW 19 57215965 start gained probably null
R2110:Ablim1 UTSW 19 57043813 missense possibly damaging 0.83
R2270:Ablim1 UTSW 19 57077431 missense possibly damaging 0.58
R2509:Ablim1 UTSW 19 57152359 missense probably damaging 1.00
R3621:Ablim1 UTSW 19 57152303 missense probably damaging 0.97
R3732:Ablim1 UTSW 19 57049460 critical splice donor site probably null
R3732:Ablim1 UTSW 19 57049460 critical splice donor site probably null
R3733:Ablim1 UTSW 19 57049460 critical splice donor site probably null
R3734:Ablim1 UTSW 19 57049460 critical splice donor site probably null
R3878:Ablim1 UTSW 19 57037210 utr 3 prime probably null
R4354:Ablim1 UTSW 19 57155278 missense probably damaging 1.00
R4543:Ablim1 UTSW 19 57077442 missense possibly damaging 0.87
R4749:Ablim1 UTSW 19 57215721 missense probably benign
R4860:Ablim1 UTSW 19 57079866 missense probably damaging 1.00
R4860:Ablim1 UTSW 19 57079866 missense probably damaging 1.00
R5072:Ablim1 UTSW 19 57073853 critical splice donor site probably null
R5277:Ablim1 UTSW 19 57155261 missense probably damaging 1.00
R5331:Ablim1 UTSW 19 57155249 missense probably damaging 1.00
R5354:Ablim1 UTSW 19 57130923 missense probably benign 0.07
R5893:Ablim1 UTSW 19 57215853 missense probably benign 0.07
R5958:Ablim1 UTSW 19 57041935 missense probably damaging 1.00
R6435:Ablim1 UTSW 19 57061355 missense possibly damaging 0.69
R6460:Ablim1 UTSW 19 57079839 missense possibly damaging 0.96
R6642:Ablim1 UTSW 19 57130852 missense probably benign 0.03
R6662:Ablim1 UTSW 19 57073853 critical splice donor site probably null
R6705:Ablim1 UTSW 19 57215821 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CATGTGGGGAGAGCTTTGTAAC -3'
(R):5'- TCGGAGTTCTAGCTCTGGACTC -3'

Sequencing Primer
(F):5'- ACTTTTGAGCATTTGGGATATACAC -3'
(R):5'- ACTCTGGGGCACTCAGTGAAG -3'
Posted On2014-08-25