Incidental Mutation 'R0142:Olfr1494'
ID22410
Institutional Source Beutler Lab
Gene Symbol Olfr1494
Ensembl Gene ENSMUSG00000050865
Gene Nameolfactory receptor 1494
SynonymsMOR266-1, GA_x6K02T2RE5P-4082427-4083374
MMRRC Submission 038427-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.116) question?
Stock #R0142 (G1)
Quality Score183
Status Validated (trace)
Chromosome19
Chromosomal Location13739728-13750479 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 13749255 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 50 (I50F)
Ref Sequence ENSEMBL: ENSMUSP00000146563 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051768] [ENSMUST00000207836]
Predicted Effect probably benign
Transcript: ENSMUST00000051768
AA Change: I50F

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000056291
Gene: ENSMUSG00000050865
AA Change: I50F

DomainStartEndE-ValueType
low complexity region 13 27 N/A INTRINSIC
Pfam:7tm_4 35 313 3.2e-53 PFAM
Pfam:7tm_1 45 295 7.5e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000207836
AA Change: I50F

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214479
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214697
Meta Mutation Damage Score 0.238 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.0%
  • 20x: 87.6%
Validation Efficiency 92% (61/66)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik A G 19: 29,718,254 S1347P possibly damaging Het
Abca6 T G 11: 110,188,641 D1229A probably damaging Het
Abhd8 A C 8: 71,461,862 F41V probably damaging Het
Ago4 T G 4: 126,516,932 E222A probably benign Het
Ap3b2 T C 7: 81,473,080 I470V probably damaging Het
Bcl9l C T 9: 44,507,112 T749M probably benign Het
Bicc1 T C 10: 70,925,370 K937E probably damaging Het
Bmi1 G A 2: 18,683,284 probably null Het
Boc A C 16: 44,490,241 I772S probably damaging Het
C2 T A 17: 34,873,528 I178F possibly damaging Het
Cacna1c G T 6: 118,603,882 A1416E probably damaging Het
Chst10 A G 1: 38,871,729 L118P probably damaging Het
Crybg1 G A 10: 43,999,063 T683I possibly damaging Het
Cul5 C T 9: 53,635,050 V314I probably damaging Het
Dnajc17 C A 2: 119,179,934 R211I probably benign Het
Emilin1 A G 5: 30,913,920 T16A probably benign Het
Ercc6l2 A C 13: 63,872,506 probably benign Het
Fsd2 T A 7: 81,559,935 D53V probably damaging Het
Galnt13 A G 2: 55,098,603 D479G probably damaging Het
Grk3 A T 5: 112,915,053 W643R probably damaging Het
Hdgf G A 3: 87,913,109 A4T possibly damaging Het
Hnrnpr T A 4: 136,327,282 V182E probably damaging Het
Ipo13 A C 4: 117,905,569 L279R probably damaging Het
Itga9 C A 9: 118,636,586 N169K probably damaging Het
Jph3 A G 8: 121,753,371 T263A possibly damaging Het
Jph4 G T 14: 55,108,326 Q625K probably benign Het
Kctd3 A C 1: 188,996,398 probably null Het
Kif26b A T 1: 178,915,389 S570C probably damaging Het
Klhl5 G A 5: 65,143,350 W164* probably null Het
Lacc1 A T 14: 77,030,799 H357Q probably benign Het
Lama2 A G 10: 27,187,845 I1316T probably benign Het
Lcp2 C T 11: 34,082,418 P332L probably damaging Het
Map3k6 A T 4: 133,250,946 H1033L probably benign Het
Mfsd2b A G 12: 4,866,234 V252A probably benign Het
Myo16 T A 8: 10,569,790 I1447N probably benign Het
Myo19 G A 11: 84,894,603 R224H probably damaging Het
Myo5a C T 9: 75,160,574 H637Y probably benign Het
Nek10 C T 14: 14,861,560 R539C possibly damaging Het
Nfix A T 8: 84,721,686 V404E probably damaging Het
Nr1i2 T C 16: 38,253,006 R203G probably benign Het
Nup210l G A 3: 90,172,113 G968D probably damaging Het
Olfr697 G T 7: 106,741,765 H56Q probably benign Het
Olfr884 A T 9: 38,048,110 H296L probably benign Het
Phlpp2 C T 8: 109,907,513 R242W probably damaging Het
Plcz1 A G 6: 140,007,697 F398S probably damaging Het
Ppfibp2 C A 7: 107,744,177 P808T probably damaging Het
Srpk2 T C 5: 23,527,930 K239E probably damaging Het
Svep1 A G 4: 58,118,232 V830A probably benign Het
Tesc A T 5: 118,056,570 I149F possibly damaging Het
Thsd7a A G 6: 12,418,335 W632R probably damaging Het
Tmprss9 A G 10: 80,894,378 D704G possibly damaging Het
Tob1 T C 11: 94,214,597 Y320H probably damaging Het
Trpm3 G T 19: 22,987,916 D1582Y probably damaging Het
Ttc28 A G 5: 111,277,457 K1716R probably benign Het
Uqcrfs1 A G 13: 30,540,942 V205A probably benign Het
Usp29 G A 7: 6,962,335 M392I probably benign Het
Uspl1 A T 5: 149,188,349 Y22F possibly damaging Het
Virma C A 4: 11,548,783 N1780K probably benign Het
Vmn1r56 C T 7: 5,196,373 A82T probably benign Het
Vmn2r5 A T 3: 64,492,588 C553S probably damaging Het
Vwce A T 19: 10,664,612 R901W probably damaging Het
Wdpcp C A 11: 21,857,444 probably null Het
Zfp423 A T 8: 87,780,340 C1000* probably null Het
Zscan20 A G 4: 128,585,837 F954L probably benign Het
Other mutations in Olfr1494
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02134:Olfr1494 APN 19 13749801 missense probably benign 0.04
IGL02335:Olfr1494 APN 19 13749934 missense probably benign 0.01
IGL02388:Olfr1494 APN 19 13749630 missense possibly damaging 0.91
IGL03231:Olfr1494 APN 19 13749385 missense probably benign 0.35
R0133:Olfr1494 UTSW 19 13749988 missense probably damaging 1.00
R0561:Olfr1494 UTSW 19 13749298 missense probably damaging 1.00
R0783:Olfr1494 UTSW 19 13749676 missense probably damaging 0.99
R1826:Olfr1494 UTSW 19 13749347 missense probably benign 0.05
R1967:Olfr1494 UTSW 19 13750053 makesense probably null
R3706:Olfr1494 UTSW 19 13749112 missense probably benign 0.42
R5417:Olfr1494 UTSW 19 13749853 missense probably benign 0.18
R6508:Olfr1494 UTSW 19 13749354 missense probably damaging 1.00
R7126:Olfr1494 UTSW 19 13749523 missense possibly damaging 0.90
R7262:Olfr1494 UTSW 19 13749171 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CACACTAGACATGCTGACTGGGAAG -3'
(R):5'- ATGCCCACTACATAGAGGACTGCC -3'

Sequencing Primer
(F):5'- GGGAAGTCTGTCCTCAATCAGTC -3'
(R):5'- ATACCTGTCATAGGCCATGACTG -3'
Posted On2013-04-16