Incidental Mutation 'R2022:Notch4'
ID224231
Institutional Source Beutler Lab
Gene Symbol Notch4
Ensembl Gene ENSMUSG00000015468
Gene Namenotch 4
SynonymsInt3, N4, Int-3
MMRRC Submission 040031-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2022 (G1)
Quality Score114
Status Not validated
Chromosome17
Chromosomal Location34564268-34588503 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 34587528 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 1813 (L1813P)
Ref Sequence ENSEMBL: ENSMUSP00000015612 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015612] [ENSMUST00000038149] [ENSMUST00000038244] [ENSMUST00000150924] [ENSMUST00000173328] [ENSMUST00000173389] [ENSMUST00000173772]
Predicted Effect probably damaging
Transcript: ENSMUST00000015612
AA Change: L1813P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000015612
Gene: ENSMUSG00000015468
AA Change: L1813P

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
EGF 24 60 3.2e-4 SMART
EGF 64 112 1.07e-5 SMART
EGF 118 152 5.49e-3 SMART
EGF 156 189 9.33e-6 SMART
EGF_CA 191 229 1.42e-10 SMART
EGF 234 271 1.11e-3 SMART
EGF 276 309 1.84e-4 SMART
EGF_CA 311 350 2.52e-11 SMART
EGF_CA 352 388 1.85e-9 SMART
EGF 392 427 1.58e-3 SMART
EGF_CA 429 470 2.46e-14 SMART
EGF_CA 472 508 5.03e-11 SMART
EGF_CA 510 546 6.74e-12 SMART
EGF_CA 548 584 2.98e-13 SMART
EGF_CA 586 622 7.63e-11 SMART
EGF_like 645 686 2.86e1 SMART
EGF 691 724 3.48e-5 SMART
EGF 729 762 3.62e-3 SMART
EGF_CA 764 800 1.48e-8 SMART
EGF 806 839 1.74e-5 SMART
EGF 844 877 2.3e-5 SMART
EGF 881 924 3.59e-7 SMART
EGF_CA 926 962 7.29e-8 SMART
EGF_CA 965 1000 4.42e-7 SMART
EGF_CA 1002 1040 4.56e-9 SMART
EGF 1045 1081 6.16e-6 SMART
EGF 1086 1122 8.65e-1 SMART
EGF 1129 1167 1.45e-2 SMART
NL 1159 1200 6.79e-13 SMART
NL 1203 1242 2.01e-15 SMART
NL 1243 1281 1.85e-14 SMART
NOD 1287 1341 4.37e-8 SMART
NODP 1373 1437 2.12e-6 SMART
transmembrane domain 1441 1463 N/A INTRINSIC
low complexity region 1525 1539 N/A INTRINSIC
ANK 1578 1623 2.5e3 SMART
ANK 1628 1657 1.12e-3 SMART
ANK 1661 1691 5.01e-1 SMART
ANK 1695 1724 1.65e-1 SMART
ANK 1728 1757 4.56e-4 SMART
ANK 1761 1790 2.88e-1 SMART
low complexity region 1889 1906 N/A INTRINSIC
low complexity region 1925 1937 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000038149
SMART Domains Protein: ENSMUSP00000040464
Gene: ENSMUSG00000034673

DomainStartEndE-ValueType
low complexity region 7 49 N/A INTRINSIC
Pfam:PBC 50 243 1.3e-97 PFAM
HOX 244 309 1.9e-18 SMART
low complexity region 327 353 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000038244
SMART Domains Protein: ENSMUSP00000045911
Gene: ENSMUSG00000034786

DomainStartEndE-ValueType
low complexity region 29 42 N/A INTRINSIC
GoLoco 61 83 2.02e-6 SMART
low complexity region 86 100 N/A INTRINSIC
GoLoco 103 125 2.42e-4 SMART
GoLoco 131 154 4.05e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126702
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128314
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141768
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150441
Predicted Effect probably benign
Transcript: ENSMUST00000150924
Predicted Effect probably benign
Transcript: ENSMUST00000151654
Predicted Effect probably benign
Transcript: ENSMUST00000151867
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156724
Predicted Effect probably benign
Transcript: ENSMUST00000173328
SMART Domains Protein: ENSMUSP00000133766
Gene: ENSMUSG00000034673

DomainStartEndE-ValueType
Pfam:PBC 1 161 5e-84 PFAM
HOX 162 227 1.9e-18 SMART
low complexity region 245 271 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173389
SMART Domains Protein: ENSMUSP00000133574
Gene: ENSMUSG00000015468

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
EGF 28 64 3.2e-4 SMART
EGF 68 116 1.07e-5 SMART
EGF 122 156 5.49e-3 SMART
EGF 160 193 9.33e-6 SMART
EGF_CA 195 233 1.42e-10 SMART
EGF 238 275 1.11e-3 SMART
EGF 280 313 1.84e-4 SMART
EGF_CA 315 354 2.52e-11 SMART
EGF_CA 356 392 1.85e-9 SMART
EGF 396 431 1.58e-3 SMART
EGF_CA 433 474 2.46e-14 SMART
EGF_CA 476 512 5.03e-11 SMART
EGF_CA 514 550 6.74e-12 SMART
EGF_CA 552 588 2.98e-13 SMART
EGF_CA 590 626 7.63e-11 SMART
EGF_like 649 690 2.86e1 SMART
EGF 695 728 3.48e-5 SMART
EGF 733 766 3.62e-3 SMART
EGF_CA 768 804 1.48e-8 SMART
EGF 810 843 1.74e-5 SMART
EGF 848 881 2.3e-5 SMART
EGF 885 928 3.59e-7 SMART
EGF_like 930 955 7.02e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173772
SMART Domains Protein: ENSMUSP00000134130
Gene: ENSMUSG00000034786

DomainStartEndE-ValueType
GoLoco 27 50 4.05e-6 SMART
Meta Mutation Damage Score 0.648 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the NOTCH family of proteins. Members of this Type I transmembrane protein family share structural characteristics including an extracellular domain consisting of multiple epidermal growth factor-like (EGF) repeats, and an intracellular domain consisting of multiple different domain types. Notch signaling is an evolutionarily conserved intercellular signaling pathway that regulates interactions between physically adjacent cells through binding of Notch family receptors to their cognate ligands. The encoded preproprotein is proteolytically processed in the trans-Golgi network to generate two polypeptide chains that heterodimerize to form the mature cell-surface receptor. This receptor may play a role in vascular, renal and hepatic development. Mutations in this gene may be associated with schizophrenia. Alternative splicing results in multiple transcript variants, at least one of which encodes an isoform that is proteolytically processed. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and fertile but exhibit a slight delay in postnatal retinal angiogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akr1cl T A 1: 65,014,698 Y271F probably benign Het
Asnsd1 A G 1: 53,347,227 S414P possibly damaging Het
Atp12a T A 14: 56,365,282 M1K probably null Het
Atp4b A C 8: 13,387,477 N225K possibly damaging Het
Auh G A 13: 52,835,496 P308L probably benign Het
Cactin C T 10: 81,322,893 T231I possibly damaging Het
Casp8ap2 T C 4: 32,644,560 V1211A probably benign Het
Ccdc180 C A 4: 45,944,418 H1423N probably benign Het
Chd9 T C 8: 91,035,054 Y2256H probably benign Het
Chst8 A G 7: 34,675,164 Y417H possibly damaging Het
Clcn6 A G 4: 148,010,652 probably null Het
Clec5a A T 6: 40,585,194 V12E probably damaging Het
Crebbp C T 16: 4,085,819 R1852H probably damaging Het
Cyp2c40 T A 19: 39,812,780 probably benign Het
Dip2c T C 13: 9,551,800 L265P probably damaging Het
Dnah3 A G 7: 119,951,242 Y3274H probably damaging Het
Dnah6 T A 6: 73,027,422 T3853S probably benign Het
Dnttip2 T C 3: 122,276,221 S362P probably damaging Het
Dst G A 1: 34,166,291 V1025I possibly damaging Het
Dym T C 18: 75,080,250 V181A probably benign Het
Elk3 T A 10: 93,265,677 I71F probably damaging Het
Epb41l4a C T 18: 33,921,840 S65N probably benign Het
Erap1 T A 13: 74,666,508 V451E probably benign Het
F830045P16Rik T A 2: 129,472,665 I231F probably damaging Het
Fahd1 T C 17: 24,849,840 I88V probably benign Het
Fam120b C T 17: 15,424,376 T744I possibly damaging Het
Fam83f T G 15: 80,692,267 V373G possibly damaging Het
Frem1 G T 4: 82,913,558 T1988K probably benign Het
Gdap1l1 A T 2: 163,447,597 T161S probably benign Het
Gm5346 A T 8: 43,625,917 C423* probably null Het
Gm597 A T 1: 28,778,153 V266D probably damaging Het
Gm6309 C T 5: 146,168,311 G264D probably benign Het
Gm9268 A G 7: 43,024,030 N171D probably benign Het
Hsd11b1 T C 1: 193,240,378 T124A probably benign Het
Ino80b A G 6: 83,124,372 M119T probably damaging Het
Kif3a G A 11: 53,570,581 V17M probably damaging Het
Krt40 T A 11: 99,539,992 E285D probably damaging Het
Lair1 C G 7: 4,063,064 probably null Het
Lvrn A G 18: 46,866,436 T290A possibly damaging Het
Macf1 G T 4: 123,472,730 A2746E probably damaging Het
Matn4 A G 2: 164,400,653 V175A probably damaging Het
Mok A T 12: 110,811,823 D216E probably benign Het
Muc15 A T 2: 110,731,476 T86S probably benign Het
Myo16 A G 8: 10,272,633 K21R probably benign Het
Ncl A G 1: 86,356,955 probably null Het
Nfrkb C T 9: 31,411,250 T872I probably benign Het
Nhlrc2 A T 19: 56,597,278 E648D probably benign Het
Nlrp9c A T 7: 26,384,796 Y453N probably damaging Het
Nrg3 T A 14: 38,376,352 D515V probably damaging Het
Nsd1 T C 13: 55,213,279 V20A probably damaging Het
Olfr825 T C 10: 130,163,180 M49V probably benign Het
Opn4 T A 14: 34,597,071 T186S probably benign Het
Pcdh15 T G 10: 74,631,193 S1684A possibly damaging Het
Phf11a T A 14: 59,294,914 E24V possibly damaging Het
Pigg A T 5: 108,312,922 probably benign Het
Plscr2 A G 9: 92,295,594 D136G probably damaging Het
Ppp3r2 T C 4: 49,681,723 I76V probably benign Het
Prdm6 A G 18: 53,464,959 probably benign Het
Prex1 A G 2: 166,575,614 W1188R possibly damaging Het
Prmt2 T A 10: 76,225,458 R65* probably null Het
Prom1 G T 5: 44,029,726 D396E probably benign Het
Ptcd3 C T 6: 71,885,553 C466Y probably damaging Het
Ptk2 A G 15: 73,242,406 V701A possibly damaging Het
Rab36 T C 10: 75,052,474 I250T probably benign Het
Rsf1 G A 7: 97,579,910 probably benign Het
Scn11a G T 9: 119,811,208 A207E possibly damaging Het
Serpinb3d A G 1: 107,078,452 V302A probably benign Het
Slc22a16 T C 10: 40,591,877 Y469H probably damaging Het
Smo A G 6: 29,754,716 N262D possibly damaging Het
Sptan1 C T 2: 30,007,561 A1212V probably damaging Het
Ssr1 C T 13: 37,989,549 A79T probably damaging Het
Tctex1d4 A G 4: 117,128,307 E109G possibly damaging Het
Tiam1 T A 16: 89,877,187 T479S probably benign Het
Tm9sf3 A G 19: 41,238,792 F280S probably damaging Het
Tmem72 T C 6: 116,696,839 H106R probably damaging Het
Tnr A G 1: 159,852,022 I189V probably benign Het
Tpbpa T A 13: 60,940,222 N50I probably benign Het
Tshz1 T A 18: 84,013,862 Y807F probably damaging Het
Tspo2 C T 17: 48,448,722 A131T possibly damaging Het
Usp16 T C 16: 87,473,126 L322P probably damaging Het
Vmn1r185 A G 7: 26,611,510 V190A possibly damaging Het
Vmn1r34 T C 6: 66,637,401 K118E possibly damaging Het
Vmn1r68 A G 7: 10,527,991 L60P probably damaging Het
Vps51 T C 19: 6,071,582 E162G probably benign Het
Wdr66 G A 5: 123,273,790 G495D probably benign Het
Yy1 CGGG CGGGGGG 12: 108,793,990 probably benign Het
Zdhhc4 C T 5: 143,321,783 R161H probably damaging Het
Zfp456 A T 13: 67,366,497 C363* probably null Het
Zfp541 T A 7: 16,082,185 S866T probably damaging Het
Other mutations in Notch4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00904:Notch4 APN 17 34575561 critical splice donor site probably null
IGL01022:Notch4 APN 17 34565697 missense probably damaging 1.00
IGL01356:Notch4 APN 17 34581026 missense possibly damaging 0.67
IGL01634:Notch4 APN 17 34572588 missense probably damaging 1.00
IGL02150:Notch4 APN 17 34584613 missense probably damaging 1.00
IGL02248:Notch4 APN 17 34587198 missense probably damaging 1.00
IGL02271:Notch4 APN 17 34568471 missense probably damaging 1.00
IGL02299:Notch4 APN 17 34578004 missense probably damaging 1.00
IGL02561:Notch4 APN 17 34568160 splice site probably benign
IGL02604:Notch4 APN 17 34565388 splice site probably null
IGL03323:Notch4 APN 17 34582471 missense probably damaging 1.00
IGL03366:Notch4 APN 17 34572568 missense probably damaging 1.00
IGL03408:Notch4 APN 17 34565568 missense probably benign 0.03
K3955:Notch4 UTSW 17 34568462 missense probably damaging 1.00
R0123:Notch4 UTSW 17 34565363 missense possibly damaging 0.85
R0366:Notch4 UTSW 17 34581499 splice site probably benign
R0446:Notch4 UTSW 17 34565363 missense possibly damaging 0.85
R0490:Notch4 UTSW 17 34582890 missense probably damaging 1.00
R0504:Notch4 UTSW 17 34575091 missense probably damaging 1.00
R0545:Notch4 UTSW 17 34583433 missense probably damaging 1.00
R0702:Notch4 UTSW 17 34575203 missense probably damaging 1.00
R0763:Notch4 UTSW 17 34565332 nonsense probably null
R0854:Notch4 UTSW 17 34568572 missense probably damaging 1.00
R1082:Notch4 UTSW 17 34587390 missense probably damaging 1.00
R1196:Notch4 UTSW 17 34568863 missense probably damaging 1.00
R1316:Notch4 UTSW 17 34567470 missense probably damaging 1.00
R1493:Notch4 UTSW 17 34567682 nonsense probably null
R1527:Notch4 UTSW 17 34565744 missense probably damaging 1.00
R1548:Notch4 UTSW 17 34568422 missense probably damaging 1.00
R1718:Notch4 UTSW 17 34576763 splice site probably benign
R1855:Notch4 UTSW 17 34580962 missense probably benign 0.05
R1988:Notch4 UTSW 17 34587588 missense possibly damaging 0.59
R2023:Notch4 UTSW 17 34587528 missense probably damaging 1.00
R2078:Notch4 UTSW 17 34568715 critical splice acceptor site probably null
R2369:Notch4 UTSW 17 34585950 missense probably benign 0.15
R3846:Notch4 UTSW 17 34578097 missense probably damaging 1.00
R3874:Notch4 UTSW 17 34578069 nonsense probably null
R4087:Notch4 UTSW 17 34584435 missense probably damaging 1.00
R4456:Notch4 UTSW 17 34583833 missense probably damaging 0.99
R4628:Notch4 UTSW 17 34570185 missense probably damaging 1.00
R4728:Notch4 UTSW 17 34570205 missense probably benign 0.00
R4778:Notch4 UTSW 17 34582511 missense possibly damaging 0.95
R4818:Notch4 UTSW 17 34578716 splice site probably benign
R4828:Notch4 UTSW 17 34570060 missense probably damaging 1.00
R4830:Notch4 UTSW 17 34570118 missense probably damaging 1.00
R4859:Notch4 UTSW 17 34587180 missense probably damaging 1.00
R4871:Notch4 UTSW 17 34577562 missense possibly damaging 0.63
R5090:Notch4 UTSW 17 34580920 missense probably damaging 0.99
R5290:Notch4 UTSW 17 34565289 missense probably benign 0.01
R5363:Notch4 UTSW 17 34587123 missense probably damaging 1.00
R5860:Notch4 UTSW 17 34582418 missense probably damaging 1.00
R6352:Notch4 UTSW 17 34567461 missense probably damaging 1.00
R6385:Notch4 UTSW 17 34573814 missense probably null 0.16
R6422:Notch4 UTSW 17 34584559 missense probably benign
R6645:Notch4 UTSW 17 34587816 missense probably benign 0.00
R6836:Notch4 UTSW 17 34586100 missense probably damaging 0.96
R6943:Notch4 UTSW 17 34583603 missense probably benign
R6991:Notch4 UTSW 17 34584800 nonsense probably null
R7078:Notch4 UTSW 17 34582546 missense possibly damaging 0.94
R7168:Notch4 UTSW 17 34572693 missense probably benign 0.05
R7182:Notch4 UTSW 17 34583499 missense probably damaging 1.00
R7240:Notch4 UTSW 17 34576471 missense probably benign 0.00
R7247:Notch4 UTSW 17 34572517 missense probably damaging 1.00
X0054:Notch4 UTSW 17 34584495 missense probably damaging 1.00
X0067:Notch4 UTSW 17 34586084 nonsense probably null
Z1088:Notch4 UTSW 17 34587915 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATCCAACAGGCTCCAAGGG -3'
(R):5'- AGTCATCCTGTGATGCCCTAGC -3'

Sequencing Primer
(F):5'- GACTCCCTAACAGTCCCTGC -3'
(R):5'- TCCGCAGCTTCCAGATCG -3'
Posted On2014-08-25