Incidental Mutation 'R0143:Dennd4b'
ID22425
Institutional Source Beutler Lab
Gene Symbol Dennd4b
Ensembl Gene ENSMUSG00000042404
Gene NameDENN/MADD domain containing 4B
Synonyms
MMRRC Submission 038428-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.271) question?
Stock #R0143 (G1)
Quality Score225
Status Validated (trace)
Chromosome3
Chromosomal Location90265185-90280669 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 90272364 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 643 (H643L)
Ref Sequence ENSEMBL: ENSMUSP00000117354 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098914] [ENSMUST00000129564]
Predicted Effect probably damaging
Transcript: ENSMUST00000098914
AA Change: H654L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000096514
Gene: ENSMUSG00000042404
AA Change: H654L

DomainStartEndE-ValueType
low complexity region 8 15 N/A INTRINSIC
low complexity region 43 57 N/A INTRINSIC
uDENN 183 290 1.15e-29 SMART
DENN 324 508 5.26e-70 SMART
dDENN 573 647 1.75e-25 SMART
low complexity region 672 690 N/A INTRINSIC
low complexity region 740 752 N/A INTRINSIC
coiled coil region 902 928 N/A INTRINSIC
low complexity region 1022 1038 N/A INTRINSIC
low complexity region 1086 1096 N/A INTRINSIC
low complexity region 1114 1127 N/A INTRINSIC
low complexity region 1131 1148 N/A INTRINSIC
low complexity region 1338 1350 N/A INTRINSIC
low complexity region 1424 1439 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000129564
AA Change: H643L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000117354
Gene: ENSMUSG00000042404
AA Change: H643L

DomainStartEndE-ValueType
low complexity region 32 46 N/A INTRINSIC
uDENN 172 279 1.15e-29 SMART
DENN 313 497 5.26e-70 SMART
dDENN 562 636 1.75e-25 SMART
low complexity region 661 679 N/A INTRINSIC
low complexity region 729 741 N/A INTRINSIC
coiled coil region 891 917 N/A INTRINSIC
low complexity region 1011 1027 N/A INTRINSIC
low complexity region 1075 1085 N/A INTRINSIC
low complexity region 1103 1116 N/A INTRINSIC
low complexity region 1120 1137 N/A INTRINSIC
low complexity region 1327 1339 N/A INTRINSIC
low complexity region 1413 1428 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000138376
SMART Domains Protein: ENSMUSP00000116003
Gene: ENSMUSG00000042404

DomainStartEndE-ValueType
coiled coil region 29 55 N/A INTRINSIC
low complexity region 148 164 N/A INTRINSIC
low complexity region 212 222 N/A INTRINSIC
low complexity region 240 253 N/A INTRINSIC
low complexity region 257 264 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000151648
SMART Domains Protein: ENSMUSP00000121350
Gene: ENSMUSG00000042404

DomainStartEndE-ValueType
uDENN 2 57 3.71e-6 SMART
Pfam:DENN 91 157 2.9e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000156358
SMART Domains Protein: ENSMUSP00000118483
Gene: ENSMUSG00000042404

DomainStartEndE-ValueType
low complexity region 24 38 N/A INTRINSIC
Blast:uDENN 39 97 9e-6 BLAST
Blast:uDENN 164 207 1e-22 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183900
Meta Mutation Damage Score 0.346 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.6%
  • 20x: 93.6%
Validation Efficiency 97% (76/78)
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim3 A T 18: 61,855,217 I145N probably benign Het
Ankrd1 G A 19: 36,119,313 A38V probably benign Het
Ankrd34b A G 13: 92,439,760 E500G probably damaging Het
Arhgef12 T C 9: 43,005,594 T419A probably damaging Het
B3galt2 A T 1: 143,647,334 N403Y possibly damaging Het
Bbx C T 16: 50,280,392 E47K probably benign Het
C4b G A 17: 34,734,219 probably benign Het
Cacna1e A T 1: 154,448,947 probably null Het
Cdh3 T C 8: 106,511,225 V17A probably benign Het
Cog7 A T 7: 121,951,164 L379Q probably damaging Het
Cul9 T C 17: 46,526,410 N1044S possibly damaging Het
Cyp4b1 C T 4: 115,635,874 D258N probably damaging Het
Ddx39 T C 8: 83,720,550 V113A probably benign Het
Dpy19l3 T C 7: 35,714,215 T334A probably benign Het
Dsg3 T C 18: 20,536,825 L632S probably damaging Het
Dtx4 G A 19: 12,486,482 T312I probably damaging Het
Dusp18 C T 11: 3,897,243 R78C probably benign Het
Fes A C 7: 80,383,895 F203V probably benign Het
Fhad1 C A 4: 141,929,646 probably benign Het
Gjb2 T C 14: 57,100,069 silent Het
Gm5828 T C 1: 16,768,355 noncoding transcript Het
Gsdma A C 11: 98,666,254 E65A probably damaging Het
Hck T A 2: 153,134,220 probably null Het
Henmt1 A T 3: 108,953,802 H47L probably damaging Het
Hivep2 T C 10: 14,129,355 F566L probably damaging Het
Hnrnpl T C 7: 28,814,192 probably benign Het
Igsf3 T C 3: 101,435,601 I518T probably damaging Het
Ireb2 T C 9: 54,885,909 F223L probably benign Het
Isoc2a T C 7: 4,891,332 probably null Het
Krt73 T A 15: 101,800,773 R200W probably damaging Het
Lgals9 T A 11: 78,963,535 I308F probably damaging Het
Lrp1 A G 10: 127,593,942 F420L probably damaging Het
Mep1b T C 18: 21,095,107 probably benign Het
Mex3a G T 3: 88,536,255 A213S probably benign Het
Mmp13 T C 9: 7,276,558 F218L probably damaging Het
Ncf1 G T 5: 134,227,137 probably benign Het
Notch2 A G 3: 98,146,117 D2032G probably damaging Het
Olfr1505 A C 19: 13,919,250 I77L probably damaging Het
Olfr491 A G 7: 108,316,995 I34V probably benign Het
Olfr63 T C 17: 33,269,497 S258P probably damaging Het
Pex16 G A 2: 92,380,457 G312D probably damaging Het
Pex5 A T 6: 124,398,489 W525R probably damaging Het
Plcb4 T A 2: 135,976,211 I799N probably damaging Het
Poldip3 G A 15: 83,127,943 L372F probably damaging Het
Polg2 C A 11: 106,777,526 V174L probably benign Het
Prrt4 C G 6: 29,170,671 G594A probably damaging Het
Prss1 A G 6: 41,463,588 D199G probably damaging Het
Rbms2 T A 10: 128,137,954 Q207L probably benign Het
Retreg2 A G 1: 75,146,430 D334G possibly damaging Het
Slc6a15 T G 10: 103,418,068 C622G probably benign Het
Spdya T A 17: 71,558,640 D84E probably damaging Het
Stat3 A T 11: 100,895,156 S432T possibly damaging Het
Tiam1 A T 16: 89,898,200 V123E probably benign Het
Tnpo3 A G 6: 29,565,652 probably benign Het
Tnrc6c A C 11: 117,752,985 N1481H probably damaging Het
Top3b T C 16: 16,883,525 S234P probably damaging Het
Tor1aip2 A T 1: 156,059,548 T10S probably benign Het
Tpsab1 T A 17: 25,343,444 H303L probably benign Het
Traf3 T A 12: 111,261,576 V407D probably damaging Het
Trim33 T A 3: 103,352,101 D1035E probably benign Het
Ttc38 T C 15: 85,853,719 V402A possibly damaging Het
Ube4b C T 4: 149,355,457 R646H possibly damaging Het
Usp8 C A 2: 126,755,089 probably benign Het
Zdbf2 A T 1: 63,308,074 I1871F probably benign Het
Zfp345 T A 2: 150,472,555 Q354L probably benign Het
Zfp462 C A 4: 55,023,402 probably benign Het
Zfp81 G A 17: 33,335,121 H240Y possibly damaging Het
Zfp830 A G 11: 82,765,168 D266G possibly damaging Het
Other mutations in Dennd4b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00321:Dennd4b APN 3 90271207 missense possibly damaging 0.83
IGL00834:Dennd4b APN 3 90279686 critical splice donor site probably null
IGL01124:Dennd4b APN 3 90269074 missense possibly damaging 0.61
IGL01792:Dennd4b APN 3 90279845 missense probably damaging 0.96
IGL01895:Dennd4b APN 3 90275567 missense probably benign 0.00
IGL02533:Dennd4b APN 3 90272310 missense probably benign 0.02
IGL02630:Dennd4b APN 3 90272977 missense probably benign 0.00
R0107:Dennd4b UTSW 3 90272736 missense possibly damaging 0.92
R1079:Dennd4b UTSW 3 90271178 missense probably benign
R1306:Dennd4b UTSW 3 90271165 missense probably benign 0.00
R1525:Dennd4b UTSW 3 90270870 missense probably damaging 0.97
R1756:Dennd4b UTSW 3 90271605 missense probably damaging 1.00
R1959:Dennd4b UTSW 3 90268773 missense probably damaging 1.00
R1976:Dennd4b UTSW 3 90273055 missense probably damaging 1.00
R2184:Dennd4b UTSW 3 90275540 missense probably damaging 1.00
R2296:Dennd4b UTSW 3 90275514 missense probably damaging 1.00
R2406:Dennd4b UTSW 3 90275488 missense probably damaging 1.00
R2408:Dennd4b UTSW 3 90271575 nonsense probably null
R4691:Dennd4b UTSW 3 90272312 missense probably damaging 1.00
R5376:Dennd4b UTSW 3 90278056 missense probably benign 0.00
R5466:Dennd4b UTSW 3 90268500 splice site probably null
R5555:Dennd4b UTSW 3 90268368 missense probably damaging 1.00
R5556:Dennd4b UTSW 3 90268368 missense probably damaging 1.00
R5557:Dennd4b UTSW 3 90268368 missense probably damaging 1.00
R5605:Dennd4b UTSW 3 90268368 missense probably damaging 1.00
R5617:Dennd4b UTSW 3 90275626 missense probably benign
R5692:Dennd4b UTSW 3 90277783 missense probably damaging 1.00
R5790:Dennd4b UTSW 3 90277450 missense probably damaging 1.00
R5957:Dennd4b UTSW 3 90270965 missense probably damaging 1.00
R6130:Dennd4b UTSW 3 90276259 missense probably damaging 1.00
R6183:Dennd4b UTSW 3 90275568 utr 3 prime probably benign
R6505:Dennd4b UTSW 3 90267611 missense probably damaging 1.00
R6631:Dennd4b UTSW 3 90277732 splice site probably null
R6801:Dennd4b UTSW 3 90268779 missense probably damaging 0.98
R7409:Dennd4b UTSW 3 90273952 missense probably benign 0.15
R7457:Dennd4b UTSW 3 90269315 missense probably benign
X0024:Dennd4b UTSW 3 90270971 missense possibly damaging 0.78
Predicted Primers PCR Primer
(F):5'- CTGTGAGCAGAGAGCTGTGGTAAC -3'
(R):5'- AGATGGCTTCTCCCAGAGACACAC -3'

Sequencing Primer
(F):5'- ACAAGCTGTACTCTCAGCTG -3'
(R):5'- AGTCCTAGAGATCTATCTGGAGG -3'
Posted On2013-04-16