Incidental Mutation 'R2034:Plxna2'
ID224269
Institutional Source Beutler Lab
Gene Symbol Plxna2
Ensembl Gene ENSMUSG00000026640
Gene Nameplexin A2
Synonyms2810428A13Rik, OCT, PlexA2, Plxn2
MMRRC Submission 040041-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2034 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location194618218-194816869 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 194780594 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 890 (I890V)
Ref Sequence ENSEMBL: ENSMUSP00000027952 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027952]
PDB Structure
Plexin A2 / Semaphorin 6A complex [X-RAY DIFFRACTION]
Mouse Plexin A2 extracellular domain [X-RAY DIFFRACTION]
Mouse Plexin A2, extracellular domains 1-4 [X-RAY DIFFRACTION]
Plexin A2 in complex with Semaphorin 6A [X-RAY DIFFRACTION]
Complex of mouse Plexin A2 - Semaphorin 3A - Neuropilin-1 [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000027952
AA Change: I890V

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000027952
Gene: ENSMUSG00000026640
AA Change: I890V

DomainStartEndE-ValueType
low complexity region 16 29 N/A INTRINSIC
Sema 50 492 1.65e-132 SMART
PSI 510 560 8e-12 SMART
PSI 655 702 6.35e-6 SMART
PSI 803 856 1.24e-8 SMART
IPT 857 952 6.36e-21 SMART
IPT 953 1038 1.02e-24 SMART
IPT 1040 1140 1.48e-21 SMART
IPT 1142 1237 8.81e-6 SMART
transmembrane domain 1238 1260 N/A INTRINSIC
Pfam:Plexin_cytopl 1311 1864 1.9e-261 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000135664
SMART Domains Protein: ENSMUSP00000118087
Gene: ENSMUSG00000026640

DomainStartEndE-ValueType
PSI 9 62 1.24e-8 SMART
Meta Mutation Damage Score 0.108 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the plexin-A family of semaphorin co-receptors. Semaphorins are a large family of secreted or membrane-bound proteins that mediate repulsive effects on axon pathfinding during nervous system development. A subset of semaphorins are recognized by plexin-A/neuropilin transmembrane receptor complexes, triggering a cellular signal transduction cascade that leads to axon repulsion. This plexin-A family member is thought to transduce signals from semaphorin-3A and -3C. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele show abnormal granule cell migration in the adult cerebellum and aberrant projection of mossy fibers in hippocampal slices. Mice homozygous for an ENU-induced allele are smaller and show granule cell migration defects and mild ataxia with incomplete penetrance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810408A11Rik T C 11: 69,900,559 I65V probably benign Het
Abca13 A G 11: 9,292,628 N1497S possibly damaging Het
Afmid C A 11: 117,835,235 N184K probably benign Het
Ampd2 A T 3: 108,077,363 I459N possibly damaging Het
Anapc1 T C 2: 128,648,458 D1018G possibly damaging Het
Ano9 T A 7: 141,108,135 I223F probably damaging Het
B3gnt6 A G 7: 98,194,018 L245P possibly damaging Het
Bag6 G A 17: 35,144,692 R784Q probably damaging Het
Brca1 C G 11: 101,489,849 S1786T probably benign Het
Btbd3 T G 2: 138,278,983 S26A probably benign Het
Cacna1d C A 14: 30,089,863 V1277L probably damaging Het
Casp12 C T 9: 5,346,491 T6I probably damaging Het
Col7a1 T C 9: 108,963,007 V1262A unknown Het
Crh C A 3: 19,694,098 G127C probably damaging Het
D5Ertd579e A T 5: 36,613,538 L64* probably null Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Ddc T A 11: 11,880,456 I63L probably benign Het
Eif3a C T 19: 60,762,130 probably benign Het
Fsip2 T A 2: 82,989,494 N5190K probably benign Het
Gm5420 A G 10: 21,691,613 noncoding transcript Het
Grb14 A G 2: 64,923,529 probably benign Het
Gsap A T 5: 21,270,595 I545F probably damaging Het
Hectd1 A T 12: 51,757,116 probably null Het
Helz2 G A 2: 181,232,578 P2041L probably damaging Het
Herc1 G A 9: 66,441,972 A2038T probably benign Het
Il10 C A 1: 131,024,185 Q152K probably benign Het
Klrg1 A G 6: 122,279,637 probably null Het
Lrig2 T C 3: 104,494,092 T160A probably benign Het
Mmd2 A T 5: 142,575,184 probably null Het
Mmp2 C T 8: 92,836,912 S338F probably damaging Het
Nalcn T G 14: 123,283,603 D1630A probably benign Het
Ncoa2 T C 1: 13,164,983 S909G probably benign Het
Neb A T 2: 52,280,611 M1683K possibly damaging Het
Nfe2l3 A G 6: 51,458,370 I637V possibly damaging Het
Npw G A 17: 24,658,268 S53F probably damaging Het
Nrbf2 A T 10: 67,275,564 probably benign Het
Nrros C T 16: 32,144,157 W311* probably null Het
Nup188 T A 2: 30,310,085 probably benign Het
Olfr1444 T A 19: 12,861,787 M4K possibly damaging Het
Olfr726 T C 14: 50,083,983 M233V probably benign Het
Parp4 A T 14: 56,634,263 I1133F probably damaging Het
Pcdhb11 T C 18: 37,422,493 V292A probably benign Het
Pcnx2 A G 8: 125,818,667 probably null Het
Phf2 A G 13: 48,817,730 S489P unknown Het
Pik3r5 T A 11: 68,493,577 N598K probably damaging Het
Pikfyve A T 1: 65,222,357 E432D probably damaging Het
Pink1 T C 4: 138,318,032 I274V possibly damaging Het
Pkhd1 G A 1: 20,200,669 T3220I probably damaging Het
Pomgnt1 T C 4: 116,157,927 V492A possibly damaging Het
Prp2 G T 6: 132,595,984 probably null Het
Rabl6 T C 2: 25,585,432 E543G possibly damaging Het
Rgp1 T A 4: 43,581,605 probably null Het
Rps6kb2 T C 19: 4,161,107 T140A probably damaging Het
S100a11 T C 3: 93,526,122 I91T probably benign Het
Serpine2 A G 1: 79,796,852 L230P probably damaging Het
Sh3tc2 A G 18: 61,987,666 D370G probably damaging Het
Sim2 A C 16: 94,085,942 I43L probably damaging Het
Skp2 C A 15: 9,113,698 G376C probably damaging Het
Slc14a2 A G 18: 78,183,583 L419P probably damaging Het
Srgap1 C T 10: 121,792,746 E817K probably damaging Het
Stag3 A G 5: 138,298,001 E442G possibly damaging Het
Sulf1 A G 1: 12,820,421 N361S probably damaging Het
Tmco6 A G 18: 36,737,856 probably null Het
Tmem104 T A 11: 115,243,547 I303N probably benign Het
Ttll6 G T 11: 96,135,526 D86Y probably damaging Het
Vmn1r120 T G 7: 21,052,958 E276A possibly damaging Het
Vmn1r64 A G 7: 5,883,989 M185T probably benign Het
Vmn2r85 A T 10: 130,426,373 probably benign Het
Vwa3a A T 7: 120,782,645 K568* probably null Het
Zcchc11 C T 4: 108,512,195 R651W probably damaging Het
Other mutations in Plxna2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00227:Plxna2 APN 1 194644657 missense probably damaging 1.00
IGL00332:Plxna2 APN 1 194789830 missense probably damaging 0.98
IGL00392:Plxna2 APN 1 194800568 missense probably damaging 1.00
IGL00432:Plxna2 APN 1 194644096 missense probably benign 0.03
IGL00704:Plxna2 APN 1 194751461 missense probably damaging 0.99
IGL00737:Plxna2 APN 1 194746239 splice site probably benign
IGL01078:Plxna2 APN 1 194786693 unclassified probably benign
IGL01354:Plxna2 APN 1 194762435 missense probably benign 0.02
IGL01432:Plxna2 APN 1 194644318 missense possibly damaging 0.58
IGL01459:Plxna2 APN 1 194764570 missense probably benign 0.00
IGL01525:Plxna2 APN 1 194712311 missense probably benign 0.00
IGL01656:Plxna2 APN 1 194790161 missense possibly damaging 0.52
IGL01825:Plxna2 APN 1 194788902 missense probably damaging 0.98
IGL01862:Plxna2 APN 1 194643950 missense possibly damaging 0.87
IGL01899:Plxna2 APN 1 194751488 missense probably damaging 1.00
IGL01996:Plxna2 APN 1 194799776 missense probably damaging 0.99
IGL02123:Plxna2 APN 1 194794383 missense probably damaging 1.00
IGL02226:Plxna2 APN 1 194644424 missense probably damaging 1.00
IGL02227:Plxna2 APN 1 194752089 missense probably damaging 1.00
IGL02415:Plxna2 APN 1 194643964 missense probably damaging 1.00
IGL02440:Plxna2 APN 1 194746150 missense probably benign 0.10
IGL02545:Plxna2 APN 1 194786690 unclassified probably benign
IGL02553:Plxna2 APN 1 194751438 missense probably benign 0.08
IGL02882:Plxna2 APN 1 194762570 missense probably damaging 1.00
IGL02946:Plxna2 APN 1 194749309 splice site probably benign
IGL03062:Plxna2 APN 1 194762550 missense possibly damaging 0.72
IGL03095:Plxna2 APN 1 194801127 missense probably damaging 1.00
IGL03293:Plxna2 APN 1 194804945 missense probably damaging 0.99
R0024:Plxna2 UTSW 1 194643995 missense possibly damaging 0.57
R0040:Plxna2 UTSW 1 194643896 missense probably benign 0.13
R0040:Plxna2 UTSW 1 194643896 missense probably benign 0.13
R0063:Plxna2 UTSW 1 194644939 missense probably benign 0.00
R0063:Plxna2 UTSW 1 194644939 missense probably benign 0.00
R0217:Plxna2 UTSW 1 194644598 missense probably damaging 1.00
R0316:Plxna2 UTSW 1 194644150 missense probably damaging 1.00
R0440:Plxna2 UTSW 1 194644404 nonsense probably null
R0505:Plxna2 UTSW 1 194644348 missense possibly damaging 0.93
R0568:Plxna2 UTSW 1 194751386 missense probably benign 0.00
R0669:Plxna2 UTSW 1 194788837 missense probably damaging 0.99
R0674:Plxna2 UTSW 1 194649475 missense probably benign 0.00
R0885:Plxna2 UTSW 1 194644556 missense probably benign
R0898:Plxna2 UTSW 1 194797024 missense probably damaging 1.00
R0940:Plxna2 UTSW 1 194800555 missense probably benign 0.01
R1061:Plxna2 UTSW 1 194644093 missense probably damaging 1.00
R1067:Plxna2 UTSW 1 194780510 splice site probably null
R1222:Plxna2 UTSW 1 194800649 missense probably damaging 1.00
R1345:Plxna2 UTSW 1 194644486 missense probably damaging 1.00
R1363:Plxna2 UTSW 1 194804939 nonsense probably null
R1432:Plxna2 UTSW 1 194767463 missense probably benign 0.10
R1434:Plxna2 UTSW 1 194751540 splice site probably benign
R1597:Plxna2 UTSW 1 194749306 splice site probably benign
R1719:Plxna2 UTSW 1 194644370 missense possibly damaging 0.93
R1778:Plxna2 UTSW 1 194810970 missense probably benign 0.01
R1795:Plxna2 UTSW 1 194806303 missense probably damaging 0.99
R1819:Plxna2 UTSW 1 194790186 missense probably benign 0.03
R1926:Plxna2 UTSW 1 194762450 missense probably benign 0.02
R1966:Plxna2 UTSW 1 194644700 missense possibly damaging 0.91
R1987:Plxna2 UTSW 1 194643989 missense probably damaging 1.00
R1988:Plxna2 UTSW 1 194643989 missense probably damaging 1.00
R2131:Plxna2 UTSW 1 194644750 missense probably benign 0.01
R2171:Plxna2 UTSW 1 194800617 missense probably damaging 1.00
R2217:Plxna2 UTSW 1 194797748 missense probably damaging 1.00
R2311:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R2340:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R2342:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R2423:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R2424:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R2425:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R2842:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R2971:Plxna2 UTSW 1 194797731 missense probably damaging 1.00
R3236:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R3731:Plxna2 UTSW 1 194788885 missense probably benign 0.42
R3783:Plxna2 UTSW 1 194807521 missense probably damaging 1.00
R3784:Plxna2 UTSW 1 194644617 missense probably benign
R3787:Plxna2 UTSW 1 194643934 missense probably benign 0.10
R3845:Plxna2 UTSW 1 194793790 missense probably damaging 0.96
R3927:Plxna2 UTSW 1 194746157 missense probably benign 0.02
R3930:Plxna2 UTSW 1 194794910 missense probably benign 0.17
R3964:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R3980:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R4067:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R4120:Plxna2 UTSW 1 194780627 missense probably damaging 1.00
R4231:Plxna2 UTSW 1 194644454 missense probably damaging 1.00
R4257:Plxna2 UTSW 1 194644775 missense probably damaging 1.00
R4396:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R4397:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R4418:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R4444:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R4446:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R4482:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R4487:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R4489:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R4571:Plxna2 UTSW 1 194810988 missense possibly damaging 0.91
R4622:Plxna2 UTSW 1 194812150 missense probably benign
R4623:Plxna2 UTSW 1 194812150 missense probably benign
R4684:Plxna2 UTSW 1 194762594 missense probably benign 0.42
R4688:Plxna2 UTSW 1 194644445 missense probably damaging 1.00
R4855:Plxna2 UTSW 1 194797732 missense probably benign 0.39
R4876:Plxna2 UTSW 1 194643775 missense probably benign 0.02
R5161:Plxna2 UTSW 1 194751404 missense probably benign
R5207:Plxna2 UTSW 1 194788899 missense probably benign 0.19
R5479:Plxna2 UTSW 1 194793873 missense probably benign
R5931:Plxna2 UTSW 1 194810870 missense probably damaging 1.00
R6026:Plxna2 UTSW 1 194799814 missense probably damaging 1.00
R6029:Plxna2 UTSW 1 194794427 missense probably benign 0.00
R6029:Plxna2 UTSW 1 194799575 missense probably damaging 1.00
R6059:Plxna2 UTSW 1 194810971 missense possibly damaging 0.79
R6238:Plxna2 UTSW 1 194790196 missense probably benign 0.01
R6322:Plxna2 UTSW 1 194754367 missense possibly damaging 0.89
R6668:Plxna2 UTSW 1 194810088 missense possibly damaging 0.68
R6709:Plxna2 UTSW 1 194789766 missense probably benign 0.01
R6748:Plxna2 UTSW 1 194794182 intron probably null
R6838:Plxna2 UTSW 1 194804914 missense possibly damaging 0.90
R6844:Plxna2 UTSW 1 194793828 missense probably benign 0.08
R7069:Plxna2 UTSW 1 194793904 missense possibly damaging 0.51
R7122:Plxna2 UTSW 1 194644568 nonsense probably null
R7145:Plxna2 UTSW 1 194649522 missense not run
X0027:Plxna2 UTSW 1 194644433 missense probably damaging 1.00
Z1088:Plxna2 UTSW 1 194644441 missense possibly damaging 0.56
Z1088:Plxna2 UTSW 1 194764539 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- ATTCTAGGAGTCTCACCAAAGTTCC -3'
(R):5'- CCCCAAAAGACTTCTTGGGAC -3'

Sequencing Primer
(F):5'- CAAAGTTCCTAAGTACTCTGTTTGGG -3'
(R):5'- CCCAAAAGACTTCTTGGGACATTTTC -3'
Posted On2014-08-25