Incidental Mutation 'R2034:Srgap1'
ID224347
Institutional Source Beutler Lab
Gene Symbol Srgap1
Ensembl Gene ENSMUSG00000020121
Gene NameSLIT-ROBO Rho GTPase activating protein 1
SynonymsArhgap13, 4930572H05Rik
MMRRC Submission 040041-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.262) question?
Stock #R2034 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location121780991-122047315 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 121792746 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 817 (E817K)
Ref Sequence ENSEMBL: ENSMUSP00000080389 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020322] [ENSMUST00000081688]
Predicted Effect possibly damaging
Transcript: ENSMUST00000020322
AA Change: E794K

PolyPhen 2 Score 0.802 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000020322
Gene: ENSMUSG00000020121
AA Change: E794K

DomainStartEndE-ValueType
FCH 22 121 3.81e-16 SMART
low complexity region 173 193 N/A INTRINSIC
coiled coil region 352 382 N/A INTRINSIC
low complexity region 405 418 N/A INTRINSIC
RhoGAP 494 668 1.27e-64 SMART
SH3 723 778 1.57e-14 SMART
low complexity region 826 840 N/A INTRINSIC
low complexity region 1004 1014 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000081688
AA Change: E817K

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000080389
Gene: ENSMUSG00000020121
AA Change: E817K

DomainStartEndE-ValueType
FCH 22 121 3.81e-16 SMART
low complexity region 173 193 N/A INTRINSIC
coiled coil region 352 382 N/A INTRINSIC
low complexity region 405 418 N/A INTRINSIC
RhoGAP 517 691 1.27e-64 SMART
SH3 746 801 1.57e-14 SMART
low complexity region 849 863 N/A INTRINSIC
low complexity region 1027 1037 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161996
Meta Mutation Damage Score 0.188 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a GTPase activator, working with the GTPase CDC42 to negatively regulate neuronal migration. The encoded protein interacts with the transmembrane receptor ROBO1 to inactivate CDC42. [provided by RefSeq, Sep 2016]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810408A11Rik T C 11: 69,900,559 I65V probably benign Het
Abca13 A G 11: 9,292,628 N1497S possibly damaging Het
Afmid C A 11: 117,835,235 N184K probably benign Het
Ampd2 A T 3: 108,077,363 I459N possibly damaging Het
Anapc1 T C 2: 128,648,458 D1018G possibly damaging Het
Ano9 T A 7: 141,108,135 I223F probably damaging Het
B3gnt6 A G 7: 98,194,018 L245P possibly damaging Het
Bag6 G A 17: 35,144,692 R784Q probably damaging Het
Brca1 C G 11: 101,489,849 S1786T probably benign Het
Btbd3 T G 2: 138,278,983 S26A probably benign Het
Cacna1d C A 14: 30,089,863 V1277L probably damaging Het
Casp12 C T 9: 5,346,491 T6I probably damaging Het
Col7a1 T C 9: 108,963,007 V1262A unknown Het
Crh C A 3: 19,694,098 G127C probably damaging Het
D5Ertd579e A T 5: 36,613,538 L64* probably null Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Ddc T A 11: 11,880,456 I63L probably benign Het
Eif3a C T 19: 60,762,130 probably benign Het
Fsip2 T A 2: 82,989,494 N5190K probably benign Het
Gm5420 A G 10: 21,691,613 noncoding transcript Het
Grb14 A G 2: 64,923,529 probably benign Het
Gsap A T 5: 21,270,595 I545F probably damaging Het
Hectd1 A T 12: 51,757,116 probably null Het
Helz2 G A 2: 181,232,578 P2041L probably damaging Het
Herc1 G A 9: 66,441,972 A2038T probably benign Het
Il10 C A 1: 131,024,185 Q152K probably benign Het
Klrg1 A G 6: 122,279,637 probably null Het
Lrig2 T C 3: 104,494,092 T160A probably benign Het
Mmd2 A T 5: 142,575,184 probably null Het
Mmp2 C T 8: 92,836,912 S338F probably damaging Het
Nalcn T G 14: 123,283,603 D1630A probably benign Het
Ncoa2 T C 1: 13,164,983 S909G probably benign Het
Neb A T 2: 52,280,611 M1683K possibly damaging Het
Nfe2l3 A G 6: 51,458,370 I637V possibly damaging Het
Npw G A 17: 24,658,268 S53F probably damaging Het
Nrbf2 A T 10: 67,275,564 probably benign Het
Nrros C T 16: 32,144,157 W311* probably null Het
Nup188 T A 2: 30,310,085 probably benign Het
Olfr1444 T A 19: 12,861,787 M4K possibly damaging Het
Olfr726 T C 14: 50,083,983 M233V probably benign Het
Parp4 A T 14: 56,634,263 I1133F probably damaging Het
Pcdhb11 T C 18: 37,422,493 V292A probably benign Het
Pcnx2 A G 8: 125,818,667 probably null Het
Phf2 A G 13: 48,817,730 S489P unknown Het
Pik3r5 T A 11: 68,493,577 N598K probably damaging Het
Pikfyve A T 1: 65,222,357 E432D probably damaging Het
Pink1 T C 4: 138,318,032 I274V possibly damaging Het
Pkhd1 G A 1: 20,200,669 T3220I probably damaging Het
Plxna2 A G 1: 194,780,594 I890V probably benign Het
Pomgnt1 T C 4: 116,157,927 V492A possibly damaging Het
Prp2 G T 6: 132,595,984 probably null Het
Rabl6 T C 2: 25,585,432 E543G possibly damaging Het
Rgp1 T A 4: 43,581,605 probably null Het
Rps6kb2 T C 19: 4,161,107 T140A probably damaging Het
S100a11 T C 3: 93,526,122 I91T probably benign Het
Serpine2 A G 1: 79,796,852 L230P probably damaging Het
Sh3tc2 A G 18: 61,987,666 D370G probably damaging Het
Sim2 A C 16: 94,085,942 I43L probably damaging Het
Skp2 C A 15: 9,113,698 G376C probably damaging Het
Slc14a2 A G 18: 78,183,583 L419P probably damaging Het
Stag3 A G 5: 138,298,001 E442G possibly damaging Het
Sulf1 A G 1: 12,820,421 N361S probably damaging Het
Tmco6 A G 18: 36,737,856 probably null Het
Tmem104 T A 11: 115,243,547 I303N probably benign Het
Ttll6 G T 11: 96,135,526 D86Y probably damaging Het
Vmn1r120 T G 7: 21,052,958 E276A possibly damaging Het
Vmn1r64 A G 7: 5,883,989 M185T probably benign Het
Vmn2r85 A T 10: 130,426,373 probably benign Het
Vwa3a A T 7: 120,782,645 K568* probably null Het
Zcchc11 C T 4: 108,512,195 R651W probably damaging Het
Other mutations in Srgap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01964:Srgap1 APN 10 121804966 missense possibly damaging 0.81
IGL02106:Srgap1 APN 10 121785693 missense possibly damaging 0.95
IGL02927:Srgap1 APN 10 121855462 missense probably damaging 0.99
IGL03088:Srgap1 APN 10 121825693 missense possibly damaging 0.94
IGL03208:Srgap1 APN 10 121792266 missense possibly damaging 0.89
IGL03251:Srgap1 APN 10 121804921 unclassified probably null
PIT1430001:Srgap1 UTSW 10 121896753 splice site probably benign
R0052:Srgap1 UTSW 10 121800827 missense possibly damaging 0.94
R0052:Srgap1 UTSW 10 121800827 missense possibly damaging 0.94
R0356:Srgap1 UTSW 10 121855536 splice site probably null
R0361:Srgap1 UTSW 10 122047192 start codon destroyed probably null 0.89
R0365:Srgap1 UTSW 10 121785705 missense possibly damaging 0.80
R0675:Srgap1 UTSW 10 121792235 missense probably damaging 1.00
R0801:Srgap1 UTSW 10 121807875 missense probably damaging 0.96
R0815:Srgap1 UTSW 10 121785474 missense probably damaging 0.99
R1034:Srgap1 UTSW 10 121785445 missense possibly damaging 0.69
R1160:Srgap1 UTSW 10 121855477 missense probably benign 0.01
R1454:Srgap1 UTSW 10 121896738 missense probably damaging 0.99
R1624:Srgap1 UTSW 10 121855373 missense probably benign 0.03
R1628:Srgap1 UTSW 10 121870339 missense probably benign 0.15
R1816:Srgap1 UTSW 10 121925971 nonsense probably null
R1933:Srgap1 UTSW 10 121925903 missense possibly damaging 0.89
R2211:Srgap1 UTSW 10 121853740 missense possibly damaging 0.55
R2295:Srgap1 UTSW 10 121794760 missense probably benign 0.03
R2368:Srgap1 UTSW 10 121829289 missense probably benign 0.05
R3796:Srgap1 UTSW 10 122047132 missense probably benign 0.06
R4083:Srgap1 UTSW 10 121785690 missense probably damaging 1.00
R4172:Srgap1 UTSW 10 121855363 missense probably benign 0.00
R4322:Srgap1 UTSW 10 121869806 missense probably damaging 1.00
R4401:Srgap1 UTSW 10 121804921 unclassified probably null
R4513:Srgap1 UTSW 10 121870326 critical splice donor site probably null
R4698:Srgap1 UTSW 10 121792487 missense probably benign 0.22
R4776:Srgap1 UTSW 10 121792351 missense probably benign 0.03
R4951:Srgap1 UTSW 10 121785552 missense probably benign 0.20
R5116:Srgap1 UTSW 10 121792379 missense possibly damaging 0.77
R5232:Srgap1 UTSW 10 121840911 missense probably benign 0.00
R5237:Srgap1 UTSW 10 121807883 missense probably damaging 1.00
R5335:Srgap1 UTSW 10 121785377 utr 3 prime probably benign
R5402:Srgap1 UTSW 10 121785760 missense probably benign 0.06
R5432:Srgap1 UTSW 10 121869823 missense probably damaging 1.00
R5456:Srgap1 UTSW 10 121869811 missense probably benign 0.45
R5669:Srgap1 UTSW 10 121804850 missense probably benign 0.00
R5682:Srgap1 UTSW 10 121805014 missense probably damaging 1.00
R5687:Srgap1 UTSW 10 121825636 missense probably damaging 1.00
R5773:Srgap1 UTSW 10 121896709 missense probably benign 0.02
R5832:Srgap1 UTSW 10 121840914 missense probably damaging 1.00
R6028:Srgap1 UTSW 10 121828730 missense probably null
R6240:Srgap1 UTSW 10 122047156 missense probably benign 0.06
R6336:Srgap1 UTSW 10 121925941 missense probably benign 0.01
R6435:Srgap1 UTSW 10 121800827 missense possibly damaging 0.94
R6597:Srgap1 UTSW 10 121792371 missense probably benign 0.11
R6798:Srgap1 UTSW 10 121925904 missense probably damaging 1.00
R6897:Srgap1 UTSW 10 121785618 missense probably damaging 0.96
X0063:Srgap1 UTSW 10 121785412 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- ACGCTTTAAGGTTGAACGTTAC -3'
(R):5'- GCCTGAAATTTTCAACCTCCTGG -3'

Sequencing Primer
(F):5'- AGGTTGAACGTTACATCTGATCG -3'
(R):5'- GAGGACTTGAGTTCGATTCCCCAC -3'
Posted On2014-08-25