Incidental Mutation 'R2035:Pla2r1'
ID224424
Institutional Source Beutler Lab
Gene Symbol Pla2r1
Ensembl Gene ENSMUSG00000054580
Gene Namephospholipase A2 receptor 1
SynonymsM-type receptor, Pla2g1br, PLA2-I receptor
MMRRC Submission 040042-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2035 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location60417543-60553308 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 60422736 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 1337 (N1337S)
Ref Sequence ENSEMBL: ENSMUSP00000108144 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112525]
Predicted Effect probably damaging
Transcript: ENSMUST00000112525
AA Change: N1337S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000108144
Gene: ENSMUSG00000054580
AA Change: N1337S

DomainStartEndE-ValueType
low complexity region 35 62 N/A INTRINSIC
RICIN 77 189 2.98e-16 SMART
FN2 209 257 1.17e-25 SMART
CLECT 267 392 7.66e-30 SMART
CLECT 415 539 1.88e-29 SMART
CLECT 552 679 5.42e-21 SMART
CLECT 699 832 3.58e-21 SMART
CLECT 847 973 7.55e-20 SMART
CLECT 992 1131 5.05e-30 SMART
CLECT 1148 1267 4.72e-21 SMART
CLECT 1281 1412 1.44e-25 SMART
transmembrane domain 1432 1454 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126327
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene represents a phospholipase A2 receptor. The encoded protein likely exists as both a transmembrane form and a soluble form. The transmembrane receptor may play a role in clearance of phospholipase A2, thereby inhibiting its action. Polymorphisms at this locus have been associated with susceptibility to idiopathic membranous nephropathy. Alternatively spliced transcript variants encoding different isoforms have been identified.[provided by RefSeq, Sep 2010]
PHENOTYPE: Homozygous null mice are viable and fertile with no overt abnormalities. These mice are more resistant to toxic effects of lipopolysaccharide than controls, suggesting a role for this gene in the progression of endotoxic shock. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik T C 13: 77,612,642 *1273Q probably null Het
2810474O19Rik G A 6: 149,329,226 V1257I possibly damaging Het
Aars2 A G 17: 45,514,801 I348V possibly damaging Het
Abca8b G A 11: 109,957,106 R788C possibly damaging Het
Abhd15 T C 11: 77,515,710 L171P probably damaging Het
Abi3bp A T 16: 56,660,218 H686L probably benign Het
Acsl1 A G 8: 46,528,584 Y456C probably damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Ash1l T A 3: 89,066,317 V2561D probably benign Het
B3galnt2 T A 13: 13,966,324 F44I probably benign Het
Bicra A T 7: 15,996,413 H24Q possibly damaging Het
Ccdc163 T C 4: 116,711,333 S195P probably damaging Het
Cd163 A T 6: 124,320,629 K911N probably damaging Het
Clcn3 A T 8: 60,934,598 S179T probably damaging Het
Dctn4 T A 18: 60,538,417 D120E possibly damaging Het
Dgcr14 A G 16: 17,910,086 probably null Het
Dnali1 C T 4: 125,059,110 V207M probably damaging Het
Dnhd1 A G 7: 105,704,921 Q3036R probably damaging Het
Dst G A 1: 34,271,413 R4098H probably damaging Het
Eml5 A T 12: 98,794,266 N1741K probably benign Het
Enah G A 1: 181,921,972 P415L probably damaging Het
F8 ATCTCTCTC ATCTCTC X: 75,322,998 probably null Het
Gm4841 T G 18: 60,269,857 Y388S probably benign Het
Grin3a T C 4: 49,771,336 T479A probably damaging Het
Gucy2e C A 11: 69,227,532 V743L probably benign Het
Il33 T A 19: 29,954,637 N143K probably damaging Het
Ism1 T A 2: 139,757,155 S349R probably damaging Het
Itgb2 T A 10: 77,547,199 D134E probably damaging Het
Kcnk1 A C 8: 126,025,369 N238T possibly damaging Het
Kcnu1 G T 8: 25,896,693 V535L probably benign Het
Muc19 T A 15: 91,892,405 noncoding transcript Het
Mycbp2 A T 14: 103,260,239 Y966N probably damaging Het
Myo19 A T 11: 84,897,608 M349L probably benign Het
Narf G A 11: 121,238,500 A37T probably benign Het
Ncapd2 T C 6: 125,184,528 N208D probably benign Het
Nr1i2 A G 16: 38,251,126 probably null Het
Olfr1354 T C 10: 78,917,587 V249A possibly damaging Het
Olfr596 T A 7: 103,310,256 H178Q probably damaging Het
Opn5 A G 17: 42,607,161 I70T probably damaging Het
Pkn2 G T 3: 142,820,587 P410T probably damaging Het
Prkd3 A T 17: 78,975,373 probably null Het
Pum2 T A 12: 8,728,638 Y429* probably null Het
Rttn T A 18: 89,020,216 V812E probably damaging Het
Rufy2 T A 10: 63,006,747 L483H probably damaging Het
Sdccag3 T A 2: 26,383,627 S374C probably damaging Het
Slc35a3 T A 3: 116,687,323 Q97L probably damaging Het
St18 A T 1: 6,802,328 M96L probably benign Het
Strc G A 2: 121,374,934 A905V probably damaging Het
Syne3 T C 12: 104,958,127 M338V probably benign Het
Syngr2 A G 11: 117,813,360 D187G probably benign Het
Tas2r109 A C 6: 132,980,460 I169R probably benign Het
Tbc1d22a T A 15: 86,391,065 probably null Het
Thbs1 T A 2: 118,118,340 probably null Het
Them6 C A 15: 74,721,675 D127E probably damaging Het
Tmem132d T C 5: 127,792,458 D604G probably damaging Het
Tnni1 A G 1: 135,805,592 T51A probably benign Het
Topors T C 4: 40,262,879 N135S probably damaging Het
Unc80 A T 1: 66,606,593 D1476V probably damaging Het
Vmn1r17 A G 6: 57,360,588 V264A probably benign Het
Vmn1r193 T A 13: 22,219,562 T87S probably benign Het
Vmn1r202 C A 13: 22,501,602 R215L probably damaging Het
Vmn2r24 A T 6: 123,816,060 N782I probably damaging Het
Vmn2r53 A G 7: 12,598,511 F404L possibly damaging Het
Xpo4 A T 14: 57,585,926 C1036S possibly damaging Het
Yae1d1 T C 13: 17,989,721 N104D probably benign Het
Zan C A 5: 137,443,947 R1901L unknown Het
Zbtb9 G A 17: 26,974,923 R434H probably damaging Het
Zdhhc23 A C 16: 43,973,508 C268G probably damaging Het
Other mutations in Pla2r1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00569:Pla2r1 APN 2 60420425 missense probably benign
IGL00886:Pla2r1 APN 2 60424324 missense probably damaging 1.00
IGL00928:Pla2r1 APN 2 60535080 missense probably damaging 0.99
IGL01361:Pla2r1 APN 2 60479470 missense probably damaging 1.00
IGL01403:Pla2r1 APN 2 60424288 missense probably damaging 0.99
IGL01475:Pla2r1 APN 2 60441081 splice site probably benign
IGL01517:Pla2r1 APN 2 60504253 missense probably damaging 1.00
IGL01646:Pla2r1 APN 2 60495364 missense probably damaging 1.00
IGL02208:Pla2r1 APN 2 60428588 missense possibly damaging 0.81
IGL02301:Pla2r1 APN 2 60452436 missense probably benign 0.01
IGL02522:Pla2r1 APN 2 60428669 missense probably benign 0.11
IGL02688:Pla2r1 APN 2 60455201 missense probably damaging 1.00
IGL02822:Pla2r1 APN 2 60455173 missense probably damaging 1.00
IGL02850:Pla2r1 APN 2 60502069 missense probably benign 0.03
IGL03233:Pla2r1 APN 2 60428580 missense possibly damaging 0.63
IGL03350:Pla2r1 APN 2 60455173 missense probably damaging 1.00
IGL02980:Pla2r1 UTSW 2 60515046 missense possibly damaging 0.77
R0105:Pla2r1 UTSW 2 60514981 missense possibly damaging 0.89
R0105:Pla2r1 UTSW 2 60514981 missense possibly damaging 0.89
R0387:Pla2r1 UTSW 2 60432601 missense probably benign 0.03
R0522:Pla2r1 UTSW 2 60479515 missense probably benign 0.01
R0550:Pla2r1 UTSW 2 60425350 critical splice donor site probably null
R0718:Pla2r1 UTSW 2 60479530 missense possibly damaging 0.55
R0906:Pla2r1 UTSW 2 60514947 missense possibly damaging 0.79
R0945:Pla2r1 UTSW 2 60458410 missense possibly damaging 0.89
R1229:Pla2r1 UTSW 2 60534762 missense probably benign 0.09
R1397:Pla2r1 UTSW 2 60534762 missense probably benign 0.09
R1667:Pla2r1 UTSW 2 60420257 missense probably benign 0.00
R1668:Pla2r1 UTSW 2 60428646 missense probably damaging 0.99
R1694:Pla2r1 UTSW 2 60441084 critical splice donor site probably null
R1864:Pla2r1 UTSW 2 60428711 missense probably benign 0.01
R2029:Pla2r1 UTSW 2 60431973 missense probably damaging 0.99
R2207:Pla2r1 UTSW 2 60458435 missense probably damaging 1.00
R2429:Pla2r1 UTSW 2 60514968 missense probably damaging 1.00
R3196:Pla2r1 UTSW 2 60522783 missense probably damaging 1.00
R3522:Pla2r1 UTSW 2 60448906 missense probably damaging 1.00
R3973:Pla2r1 UTSW 2 60448962 missense probably benign 0.30
R4006:Pla2r1 UTSW 2 60522873 missense probably damaging 1.00
R4091:Pla2r1 UTSW 2 60432593 missense probably damaging 1.00
R4158:Pla2r1 UTSW 2 60422622 missense probably damaging 0.97
R4160:Pla2r1 UTSW 2 60422622 missense probably damaging 0.97
R4168:Pla2r1 UTSW 2 60497614 nonsense probably null
R4541:Pla2r1 UTSW 2 60427738 missense probably damaging 1.00
R4712:Pla2r1 UTSW 2 60428650 missense probably damaging 1.00
R4797:Pla2r1 UTSW 2 60504180 missense possibly damaging 0.47
R4884:Pla2r1 UTSW 2 60534984 missense probably damaging 1.00
R4923:Pla2r1 UTSW 2 60422712 missense probably benign 0.31
R5017:Pla2r1 UTSW 2 60522760 splice site probably null
R5116:Pla2r1 UTSW 2 60448906 missense probably damaging 1.00
R5641:Pla2r1 UTSW 2 60514984 missense probably damaging 1.00
R5807:Pla2r1 UTSW 2 60428721 missense possibly damaging 0.78
R5898:Pla2r1 UTSW 2 60422760 missense probably damaging 1.00
R6241:Pla2r1 UTSW 2 60502199 splice site probably null
R6923:Pla2r1 UTSW 2 60514966 missense probably benign 0.11
R7020:Pla2r1 UTSW 2 60447399 missense possibly damaging 0.79
R7028:Pla2r1 UTSW 2 60458393 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GCATTAACCAGGGTCAATATGAAG -3'
(R):5'- ACTTTCTATGTGACCGCCTG -3'

Sequencing Primer
(F):5'- AACCAGGGTCAATATGAAGAAATTC -3'
(R):5'- GCCTGGCTGGATACGTATC -3'
Posted On2014-08-25