Incidental Mutation 'R2035:Kcnu1'
ID224479
Institutional Source Beutler Lab
Gene Symbol Kcnu1
Ensembl Gene ENSMUSG00000031576
Gene Namepotassium channel, subfamily U, member 1
SynonymsKcnma3, Slo3
MMRRC Submission 040042-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2035 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location25849623-25937939 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 25896693 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 535 (V535L)
Ref Sequence ENSEMBL: ENSMUSP00000096457 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098858]
Predicted Effect probably benign
Transcript: ENSMUST00000098858
AA Change: V535L

PolyPhen 2 Score 0.351 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000096457
Gene: ENSMUSG00000031576
AA Change: V535L

DomainStartEndE-ValueType
transmembrane domain 27 49 N/A INTRINSIC
Pfam:Ion_trans 101 323 6.9e-21 PFAM
Pfam:Ion_trans_2 229 317 4.7e-12 PFAM
low complexity region 367 380 N/A INTRINSIC
Pfam:BK_channel_a 462 557 1.2e-28 PFAM
low complexity region 670 689 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the potassium channel family of proteins. The encoded voltage-gated ion channel allows the outward flow of potassium ions during plasma membrane hyperpolarization in sperm. Opening of this channel may be regulated by calcium ion levels. Homozygous knockout mice that lack the related mouse gene exhibit male sterility. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
PHENOTYPE: Homozygous male mutants are infertile with impaired sperm capacitation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik T C 13: 77,612,642 *1273Q probably null Het
2810474O19Rik G A 6: 149,329,226 V1257I possibly damaging Het
Aars2 A G 17: 45,514,801 I348V possibly damaging Het
Abca8b G A 11: 109,957,106 R788C possibly damaging Het
Abhd15 T C 11: 77,515,710 L171P probably damaging Het
Abi3bp A T 16: 56,660,218 H686L probably benign Het
Acsl1 A G 8: 46,528,584 Y456C probably damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Ash1l T A 3: 89,066,317 V2561D probably benign Het
B3galnt2 T A 13: 13,966,324 F44I probably benign Het
Bicra A T 7: 15,996,413 H24Q possibly damaging Het
Ccdc163 T C 4: 116,711,333 S195P probably damaging Het
Cd163 A T 6: 124,320,629 K911N probably damaging Het
Clcn3 A T 8: 60,934,598 S179T probably damaging Het
Dctn4 T A 18: 60,538,417 D120E possibly damaging Het
Dgcr14 A G 16: 17,910,086 probably null Het
Dnali1 C T 4: 125,059,110 V207M probably damaging Het
Dnhd1 A G 7: 105,704,921 Q3036R probably damaging Het
Dst G A 1: 34,271,413 R4098H probably damaging Het
Eml5 A T 12: 98,794,266 N1741K probably benign Het
Enah G A 1: 181,921,972 P415L probably damaging Het
F8 ATCTCTCTC ATCTCTC X: 75,322,998 probably null Het
Gm4841 T G 18: 60,269,857 Y388S probably benign Het
Grin3a T C 4: 49,771,336 T479A probably damaging Het
Gucy2e C A 11: 69,227,532 V743L probably benign Het
Il33 T A 19: 29,954,637 N143K probably damaging Het
Ism1 T A 2: 139,757,155 S349R probably damaging Het
Itgb2 T A 10: 77,547,199 D134E probably damaging Het
Kcnk1 A C 8: 126,025,369 N238T possibly damaging Het
Muc19 T A 15: 91,892,405 noncoding transcript Het
Mycbp2 A T 14: 103,260,239 Y966N probably damaging Het
Myo19 A T 11: 84,897,608 M349L probably benign Het
Narf G A 11: 121,238,500 A37T probably benign Het
Ncapd2 T C 6: 125,184,528 N208D probably benign Het
Nr1i2 A G 16: 38,251,126 probably null Het
Olfr1354 T C 10: 78,917,587 V249A possibly damaging Het
Olfr596 T A 7: 103,310,256 H178Q probably damaging Het
Opn5 A G 17: 42,607,161 I70T probably damaging Het
Pkn2 G T 3: 142,820,587 P410T probably damaging Het
Pla2r1 T C 2: 60,422,736 N1337S probably damaging Het
Prkd3 A T 17: 78,975,373 probably null Het
Pum2 T A 12: 8,728,638 Y429* probably null Het
Rttn T A 18: 89,020,216 V812E probably damaging Het
Rufy2 T A 10: 63,006,747 L483H probably damaging Het
Sdccag3 T A 2: 26,383,627 S374C probably damaging Het
Slc35a3 T A 3: 116,687,323 Q97L probably damaging Het
St18 A T 1: 6,802,328 M96L probably benign Het
Strc G A 2: 121,374,934 A905V probably damaging Het
Syne3 T C 12: 104,958,127 M338V probably benign Het
Syngr2 A G 11: 117,813,360 D187G probably benign Het
Tas2r109 A C 6: 132,980,460 I169R probably benign Het
Tbc1d22a T A 15: 86,391,065 probably null Het
Thbs1 T A 2: 118,118,340 probably null Het
Them6 C A 15: 74,721,675 D127E probably damaging Het
Tmem132d T C 5: 127,792,458 D604G probably damaging Het
Tnni1 A G 1: 135,805,592 T51A probably benign Het
Topors T C 4: 40,262,879 N135S probably damaging Het
Unc80 A T 1: 66,606,593 D1476V probably damaging Het
Vmn1r17 A G 6: 57,360,588 V264A probably benign Het
Vmn1r193 T A 13: 22,219,562 T87S probably benign Het
Vmn1r202 C A 13: 22,501,602 R215L probably damaging Het
Vmn2r24 A T 6: 123,816,060 N782I probably damaging Het
Vmn2r53 A G 7: 12,598,511 F404L possibly damaging Het
Xpo4 A T 14: 57,585,926 C1036S possibly damaging Het
Yae1d1 T C 13: 17,989,721 N104D probably benign Het
Zan C A 5: 137,443,947 R1901L unknown Het
Zbtb9 G A 17: 26,974,923 R434H probably damaging Het
Zdhhc23 A C 16: 43,973,508 C268G probably damaging Het
Other mutations in Kcnu1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Kcnu1 APN 8 25897856 missense probably benign 0.00
IGL00580:Kcnu1 APN 8 25865663 missense probably benign 0.04
IGL00675:Kcnu1 APN 8 25851849 missense probably benign
IGL00928:Kcnu1 APN 8 25849735 missense probably damaging 1.00
IGL01324:Kcnu1 APN 8 25849707 missense probably benign 0.22
IGL01346:Kcnu1 APN 8 25934523 splice site probably benign
IGL01361:Kcnu1 APN 8 25886768 missense possibly damaging 0.78
IGL01651:Kcnu1 APN 8 25861095 missense probably damaging 1.00
IGL01795:Kcnu1 APN 8 25913705 missense probably damaging 1.00
IGL01800:Kcnu1 APN 8 25937500 missense probably damaging 1.00
IGL01975:Kcnu1 APN 8 25934497 missense probably benign 0.29
IGL02103:Kcnu1 APN 8 25905948 missense possibly damaging 0.83
IGL02109:Kcnu1 APN 8 25937699 missense possibly damaging 0.66
IGL02127:Kcnu1 APN 8 25892062 missense probably damaging 1.00
IGL02170:Kcnu1 APN 8 25937560 missense probably damaging 1.00
IGL02217:Kcnu1 APN 8 25858184 missense probably damaging 1.00
IGL02385:Kcnu1 APN 8 25932270 missense probably damaging 1.00
IGL02493:Kcnu1 APN 8 25937520 missense possibly damaging 0.68
IGL02883:Kcnu1 APN 8 25849827 missense probably benign
IGL02884:Kcnu1 APN 8 25921528 missense probably damaging 1.00
IGL03022:Kcnu1 APN 8 25937586 missense probably damaging 0.98
IGL03281:Kcnu1 APN 8 25892077 missense probably null 1.00
IGL03345:Kcnu1 APN 8 25881293 splice site probably benign
P0026:Kcnu1 UTSW 8 25892122 missense probably damaging 1.00
PIT4677001:Kcnu1 UTSW 8 25905993 missense probably benign
R0001:Kcnu1 UTSW 8 25859270 missense probably damaging 1.00
R0419:Kcnu1 UTSW 8 25937618 missense probably benign 0.13
R0518:Kcnu1 UTSW 8 25910888 missense probably damaging 1.00
R0521:Kcnu1 UTSW 8 25910888 missense probably damaging 1.00
R0581:Kcnu1 UTSW 8 25937501 missense probably damaging 1.00
R0840:Kcnu1 UTSW 8 25913684 start codon destroyed probably null 1.00
R1282:Kcnu1 UTSW 8 25905957 missense probably benign 0.02
R1556:Kcnu1 UTSW 8 25861191 critical splice donor site probably null
R1600:Kcnu1 UTSW 8 25849793 missense probably damaging 1.00
R2011:Kcnu1 UTSW 8 25918442 missense probably benign 0.03
R2082:Kcnu1 UTSW 8 25921549 missense probably damaging 1.00
R2132:Kcnu1 UTSW 8 25851900 missense probably damaging 0.99
R2415:Kcnu1 UTSW 8 25910878 missense probably benign
R2513:Kcnu1 UTSW 8 25905966 missense probably benign 0.00
R3712:Kcnu1 UTSW 8 25881420 missense probably damaging 1.00
R3749:Kcnu1 UTSW 8 25886770 missense probably null 0.01
R3840:Kcnu1 UTSW 8 25885352 missense possibly damaging 0.95
R3874:Kcnu1 UTSW 8 25885317 missense probably damaging 1.00
R4184:Kcnu1 UTSW 8 25862417 missense probably damaging 1.00
R4576:Kcnu1 UTSW 8 25890020 missense probably benign 0.06
R4658:Kcnu1 UTSW 8 25937555 missense probably damaging 1.00
R4667:Kcnu1 UTSW 8 25910921 missense possibly damaging 0.69
R4791:Kcnu1 UTSW 8 25913752 missense probably damaging 1.00
R4940:Kcnu1 UTSW 8 25897862 splice site probably null
R5120:Kcnu1 UTSW 8 25934488 missense possibly damaging 0.79
R5314:Kcnu1 UTSW 8 25862458 missense probably damaging 0.97
R5712:Kcnu1 UTSW 8 25919650 missense probably damaging 1.00
R5807:Kcnu1 UTSW 8 25849714 missense possibly damaging 0.78
R6237:Kcnu1 UTSW 8 25932334 missense probably benign
R6260:Kcnu1 UTSW 8 25851891 missense probably damaging 1.00
R6360:Kcnu1 UTSW 8 25861180 missense possibly damaging 0.73
R6612:Kcnu1 UTSW 8 25918316 missense probably benign 0.10
R6708:Kcnu1 UTSW 8 25937711 missense probably benign
R6765:Kcnu1 UTSW 8 25913645 missense probably damaging 1.00
R6816:Kcnu1 UTSW 8 25937734 nonsense probably null
R7030:Kcnu1 UTSW 8 25918463 missense probably benign 0.00
R7202:Kcnu1 UTSW 8 25919581 splice site probably null
R7208:Kcnu1 UTSW 8 25919637 nonsense probably null
R7411:Kcnu1 UTSW 8 25892088 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTCTGCCTCCATGTATGTCTG -3'
(R):5'- TTGCTCTAGAGGCACTGACTTC -3'

Sequencing Primer
(F):5'- TTCCACATGAACACCAGGATTGTG -3'
(R):5'- AGAGGCACTGACTTCACTGTTC -3'
Posted On2014-08-25