Incidental Mutation 'R1998:Tlr4'
ID224510
Institutional Source Beutler Lab
Gene Symbol Tlr4
Ensembl Gene ENSMUSG00000039005
Gene Nametoll-like receptor 4
SynonymsRasl2-8, Lps, lipopolysaccharide response
MMRRC Submission 040008-MU
Accession Numbers

MGI: 96824

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1998 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location66827584-66930284 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 66840470 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 500 (D500V)
Ref Sequence ENSEMBL: ENSMUSP00000045770 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048096] [ENSMUST00000107365]
PDB Structure
Crystal structure of mouse TLR4 and mouse MD-2 complex [X-RAY DIFFRACTION]
Crystal structure of mouse TLR4/MD-2/lipid IVa complex [X-RAY DIFFRACTION]
Crystal structure of mouse TLR4/MD-2/LPS complex [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000048096
AA Change: D500V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000045770
Gene: ENSMUSG00000039005
AA Change: D500V

DomainStartEndE-ValueType
LRR 76 99 7.36e0 SMART
LRR 100 123 1.86e0 SMART
LRR 173 196 8.24e0 SMART
LRR 370 401 4.33e1 SMART
LRR 468 492 2.54e2 SMART
LRR 493 516 1.86e2 SMART
LRR 517 540 1.67e2 SMART
LRR 541 563 1.92e2 SMART
LRRCT 576 626 4.74e-3 SMART
transmembrane domain 636 658 N/A INTRINSIC
TIR 671 816 7.3e-39 SMART
low complexity region 822 833 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107365
SMART Domains Protein: ENSMUSP00000102988
Gene: ENSMUSG00000039005

DomainStartEndE-ValueType
PDB:3VQ2|B 22 86 2e-38 PDB
SCOP:d1m0za_ 27 86 4e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143580
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147008
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: This gene belongs to the evolutionarily-conserved Toll-like receptor family, whose members are type-1 transmembrane proteins that are involved in innate immunity. Toll-like receptors are characterized by an extracellular leucine-rich repeat domain that functions in ligand recognition and an intracellular toll/interleukin-1 receptor-like domain that is crucial for signal transduction. The receptor encoded by this gene mediates the innate immune response to bacterial lipopolysaccharide, a major component of the outer membrane of Gram-negative bacteria, through synthesis of pro-inflammatory cytokines and chemokines. In addition, this protein can recognize other pathogens from Gram-negative and Gram-positive bacteria as well as viral components. Mice deficient in this gene display a number of immune response-related phenotypes including hyporesponsiveness to bacterial lipopolysaccharide and increased levels of respiratory syncytial virus compared to controls. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygotes for spontaneous or targeted mutations are hyporesponsive to bacterial lipopolysaccharide and more susceptible to infection by gram negative bacteria. [provided by MGI curators]
Allele List at MGI

All alleles(10) : Targeted(2) Spontaneous(6) Chemically induced(2)

Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik T G 5: 87,970,694 N12K probably damaging Het
2700049A03Rik T A 12: 71,188,619 S1114R possibly damaging Het
4931409K22Rik G A 5: 24,545,006 R680C probably benign Het
Acot1 T A 12: 84,009,753 W82R probably damaging Het
Adam22 T C 5: 8,329,995 D101G probably damaging Het
Adcy9 T C 16: 4,297,412 D942G probably benign Het
Adgrg3 T G 8: 95,036,668 L244V probably damaging Het
Amh AGCGCCTTGG AG 10: 80,805,585 probably null Het
Brinp1 C T 4: 68,762,553 G580E probably damaging Het
Brwd1 G A 16: 96,021,288 T1239M probably damaging Het
Camk1d A T 2: 5,362,025 Y134* probably null Het
Camta1 T C 4: 151,077,880 Y1560C probably damaging Het
Cbfa2t2 T A 2: 154,504,789 L139M probably damaging Het
Cd226 T C 18: 89,207,219 V80A probably damaging Het
Dgka C T 10: 128,729,939 V367I probably benign Het
Dnajb13 A T 7: 100,504,610 I206N probably benign Het
Dst A T 1: 34,256,347 Q5693L probably damaging Het
Ear6 T A 14: 51,854,215 I73N probably benign Het
Egr1 A G 18: 34,861,534 I16V probably benign Het
Eif2s1 T A 12: 78,866,734 C70S possibly damaging Het
Epcam T C 17: 87,640,474 V124A probably damaging Het
Erbb2 T A 11: 98,428,953 C624S probably damaging Het
Fam135b T A 15: 71,452,404 H1238L probably damaging Het
Fam90a1a A G 8: 21,963,697 D356G probably benign Het
Fbrsl1 G A 5: 110,376,439 S127L probably benign Het
Fndc3c1 C T X: 106,420,705 E1276K probably benign Het
Gbe1 A T 16: 70,569,041 N702I probably damaging Het
Gm10643 A T 8: 84,064,424 C20* probably null Het
Gpr156 A G 16: 37,997,908 N322S possibly damaging Het
Gsdma T A 11: 98,673,694 I333N probably damaging Het
Gstm1 A G 3: 108,014,811 F170S probably damaging Het
Hgsnat C T 8: 25,945,252 W618* probably null Het
Htr5a G A 5: 27,850,889 V293M possibly damaging Het
Hyal4 A G 6: 24,756,311 E176G probably benign Het
Jag1 T C 2: 137,090,938 D546G probably damaging Het
Kbtbd3 A G 9: 4,330,760 E378G probably benign Het
Lipo4 A G 19: 33,514,301 V94A probably damaging Het
Magea10 A T X: 72,382,773 I205K probably benign Het
Manea A G 4: 26,327,871 L390P probably damaging Het
Mars T A 10: 127,300,478 K493* probably null Het
Mars T C 10: 127,302,871 I439V probably benign Het
Mboat2 A G 12: 24,946,673 D225G possibly damaging Het
Mcmbp T A 7: 128,709,163 E350V probably damaging Het
Mki67 A G 7: 135,705,770 M459T probably benign Het
Mlf1 G A 3: 67,395,291 G165R probably damaging Het
Mtmr14 A G 6: 113,277,924 D294G probably null Het
Nlrp4e A C 7: 23,321,246 Y386S probably benign Het
Nomo1 A G 7: 46,033,944 D38G possibly damaging Het
Nudcd2 T C 11: 40,734,017 W18R probably damaging Het
Olfr1140 T C 2: 87,746,972 Y259H probably damaging Het
Olfr1155 G A 2: 87,943,146 L161F probably benign Het
Olfr401 A G 11: 74,121,580 Y97C probably benign Het
Olfr677 G T 7: 105,056,905 V220L probably benign Het
Olfr742 T A 14: 50,515,356 C51S probably benign Het
Pcnx2 A T 8: 125,887,143 V523D probably damaging Het
Pkd1 T C 17: 24,573,014 V1225A probably damaging Het
Plekhh2 T A 17: 84,606,877 L1236Q possibly damaging Het
Ppp2r1b A G 9: 50,883,585 D570G probably damaging Het
Prrc2c T A 1: 162,704,918 probably benign Het
Rai14 C T 15: 10,594,981 probably null Het
Rap1gap2 A G 11: 74,395,833 L547P probably benign Het
Rims3 A T 4: 120,891,358 M259L probably benign Het
Rsbn1l G A 5: 20,902,370 H549Y probably damaging Het
Sart3 A C 5: 113,747,921 probably null Het
Scn7a C A 2: 66,683,269 G1156C probably damaging Het
Sh3rf2 T A 18: 42,141,083 V438D probably damaging Het
Slitrk6 T C 14: 110,751,823 I151V probably damaging Het
Smarca2 A T 19: 26,631,093 Q260L probably benign Het
Smco1 A G 16: 32,273,840 R110G probably damaging Het
Spef2 T A 15: 9,668,903 probably null Het
Stab1 T A 14: 31,162,153 K219* probably null Het
Sulf1 G T 1: 12,858,834 E869* probably null Het
Susd1 T C 4: 59,349,925 I557V probably benign Het
Szt2 A G 4: 118,375,727 probably null Het
Tas1r3 A T 4: 155,862,920 C103S probably damaging Het
Thg1l C A 11: 45,950,203 W243L possibly damaging Het
Tmem72 A G 6: 116,716,564 V5A probably benign Het
Tns4 T G 11: 99,085,703 M131L probably benign Het
Trim66 C T 7: 109,484,577 probably null Het
Ttll6 T A 11: 96,139,775 probably null Het
Ttn A T 2: 76,969,703 I387N probably damaging Het
Ubqln5 T A 7: 104,128,741 Q292L probably damaging Het
Vmn1r74 G T 7: 11,847,375 V201F probably damaging Het
Vmn2r28 G T 7: 5,488,314 D311E possibly damaging Het
Vtn T A 11: 78,499,716 V67E probably damaging Het
Xirp2 T A 2: 67,509,049 F545I probably damaging Het
Other mutations in Tlr4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01120:Tlr4 APN 4 66840425 missense probably benign 0.01
IGL01343:Tlr4 APN 4 66833887 unclassified probably benign
IGL01669:Tlr4 APN 4 66841267 missense possibly damaging 0.48
IGL01875:Tlr4 APN 4 66839489 missense probably damaging 1.00
IGL02138:Tlr4 APN 4 66840965 missense probably damaging 0.99
IGL02244:Tlr4 APN 4 66834061 unclassified probably null
IGL02793:Tlr4 APN 4 66839444 missense probably damaging 1.00
IGL03269:Tlr4 APN 4 66840796 missense probably damaging 1.00
IGL03288:Tlr4 APN 4 66839753 missense probably damaging 0.99
bugsy UTSW 4 66839254 nonsense probably null
cruyff UTSW 4 66840326 missense probably damaging 1.00
don_knotts UTSW 4 66841172 missense probably damaging 1.00
Guardiola UTSW 4 66839303 missense probably damaging 1.00
Lops UTSW 4 66833880 splice acceptor site probably null
lps3 UTSW 4 66841097 missense probably damaging 1.00
Lps4 UTSW 4 66841142 missense probably damaging 1.00
milquetoast UTSW 4 66839444 missense probably damaging 1.00
R0449:Tlr4 UTSW 4 66839620 missense probably damaging 0.99
R0481:Tlr4 UTSW 4 66827916 missense probably benign 0.05
R0576:Tlr4 UTSW 4 66839495 missense probably benign 0.00
R0827:Tlr4 UTSW 4 66833880 splice site probably null
R1488:Tlr4 UTSW 4 66839549 missense probably damaging 1.00
R1490:Tlr4 UTSW 4 66839374 missense possibly damaging 0.56
R1522:Tlr4 UTSW 4 66839696 missense possibly damaging 0.80
R1616:Tlr4 UTSW 4 66839480 missense probably damaging 1.00
R1681:Tlr4 UTSW 4 66841105 missense probably damaging 1.00
R1738:Tlr4 UTSW 4 66841076 missense probably benign 0.19
R1888:Tlr4 UTSW 4 66841172 missense probably damaging 1.00
R1888:Tlr4 UTSW 4 66841172 missense probably damaging 1.00
R1929:Tlr4 UTSW 4 66839444 missense probably damaging 1.00
R1982:Tlr4 UTSW 4 66841035 missense probably benign 0.40
R2186:Tlr4 UTSW 4 66839983 missense possibly damaging 0.63
R2305:Tlr4 UTSW 4 66840101 missense probably damaging 1.00
R3011:Tlr4 UTSW 4 66839254 nonsense probably null
R3420:Tlr4 UTSW 4 66839536 missense probably benign 0.37
R3422:Tlr4 UTSW 4 66839536 missense probably benign 0.37
R3818:Tlr4 UTSW 4 66841316 missense probably benign 0.00
R4212:Tlr4 UTSW 4 66840326 missense probably damaging 1.00
R4213:Tlr4 UTSW 4 66840326 missense probably damaging 1.00
R4417:Tlr4 UTSW 4 66839303 missense probably damaging 1.00
R4630:Tlr4 UTSW 4 66839240 missense probably benign 0.44
R4735:Tlr4 UTSW 4 66841198 missense probably damaging 1.00
R5191:Tlr4 UTSW 4 66841379 missense probably damaging 0.96
R5613:Tlr4 UTSW 4 66840885 missense possibly damaging 0.94
R5705:Tlr4 UTSW 4 66833980 missense probably damaging 1.00
R5726:Tlr4 UTSW 4 66840415 missense probably benign
R6021:Tlr4 UTSW 4 66840866 missense probably damaging 1.00
R6159:Tlr4 UTSW 4 66839833 missense possibly damaging 0.92
R6227:Tlr4 UTSW 4 66840595 missense probably benign
X0064:Tlr4 UTSW 4 66840140 missense probably damaging 0.99
Z1088:Tlr4 UTSW 4 66929082 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GCACCTGGATTTTCAGCACTC -3'
(R):5'- GATGTCTCTATGCGATTGAAACTGC -3'

Sequencing Primer
(F):5'- AGGGTCACAGAATTCTCAGCGTTC -3'
(R):5'- CAATCAAGAGTGCTGAGGGAATAC -3'
Posted On2014-08-25