Incidental Mutation 'R1998:Pcnx2'
ID224572
Institutional Source Beutler Lab
Gene Symbol Pcnx2
Ensembl Gene ENSMUSG00000060212
Gene Namepecanex homolog 2
SynonymsPcnxl2, E330039K12Rik
MMRRC Submission 040008-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.171) question?
Stock #R1998 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location125751508-125898317 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 125887143 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 523 (V523D)
Ref Sequence ENSEMBL: ENSMUSP00000119965 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047239] [ENSMUST00000131127]
Predicted Effect probably damaging
Transcript: ENSMUST00000047239
AA Change: V523D

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000042294
Gene: ENSMUSG00000060212
AA Change: V523D

DomainStartEndE-ValueType
transmembrane domain 36 53 N/A INTRINSIC
transmembrane domain 60 82 N/A INTRINSIC
low complexity region 94 104 N/A INTRINSIC
low complexity region 391 415 N/A INTRINSIC
low complexity region 457 476 N/A INTRINSIC
low complexity region 727 742 N/A INTRINSIC
low complexity region 806 817 N/A INTRINSIC
transmembrane domain 823 842 N/A INTRINSIC
transmembrane domain 849 866 N/A INTRINSIC
transmembrane domain 881 902 N/A INTRINSIC
transmembrane domain 934 956 N/A INTRINSIC
transmembrane domain 976 998 N/A INTRINSIC
transmembrane domain 1011 1030 N/A INTRINSIC
transmembrane domain 1080 1102 N/A INTRINSIC
transmembrane domain 1104 1126 N/A INTRINSIC
Pfam:Pecanex_C 1603 1828 3.5e-113 PFAM
low complexity region 1864 1889 N/A INTRINSIC
low complexity region 1968 1981 N/A INTRINSIC
low complexity region 2004 2019 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000131127
AA Change: V523D

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000119965
Gene: ENSMUSG00000060212
AA Change: V523D

DomainStartEndE-ValueType
transmembrane domain 36 53 N/A INTRINSIC
transmembrane domain 60 82 N/A INTRINSIC
low complexity region 94 104 N/A INTRINSIC
low complexity region 391 415 N/A INTRINSIC
low complexity region 457 476 N/A INTRINSIC
low complexity region 727 742 N/A INTRINSIC
low complexity region 806 817 N/A INTRINSIC
transmembrane domain 823 842 N/A INTRINSIC
transmembrane domain 849 866 N/A INTRINSIC
transmembrane domain 934 956 N/A INTRINSIC
transmembrane domain 968 990 N/A INTRINSIC
transmembrane domain 1010 1029 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187772
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene contains coding mononucleotide repeats that are associated with tumors of high mcrosatellite instability (MSI-H). Defects in this gene are involved in the tumorigenesis of MSI-H colorectal carcinomas. [provided by RefSeq, Jun 2016]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik T G 5: 87,970,694 N12K probably damaging Het
2700049A03Rik T A 12: 71,188,619 S1114R possibly damaging Het
4931409K22Rik G A 5: 24,545,006 R680C probably benign Het
Acot1 T A 12: 84,009,753 W82R probably damaging Het
Adam22 T C 5: 8,329,995 D101G probably damaging Het
Adcy9 T C 16: 4,297,412 D705G probably benign Het
Adgrg3 T G 8: 95,036,668 L244V probably damaging Het
Amh AGCGCCTTGG AG 10: 80,805,585 probably null Het
Brinp1 C T 4: 68,762,553 G580E probably damaging Het
Brwd1 G A 16: 96,021,288 T1239M probably damaging Het
Camk1d A T 2: 5,362,025 Y126* probably null Het
Camta1 T C 4: 151,077,880 Y1560C probably damaging Het
Cbfa2t2 T A 2: 154,504,789 L139M probably damaging Het
Cd226 T C 18: 89,207,219 V80A probably damaging Het
Dgka C T 10: 128,729,939 V367I probably benign Het
Dnajb13 A T 7: 100,504,610 I206N probably benign Het
Dst A T 1: 34,256,347 Q5693L probably damaging Het
Ear6 T A 14: 51,854,215 I73N probably benign Het
Egr1 A G 18: 34,861,534 I16V probably benign Het
Eif2s1 T A 12: 78,866,734 C70S possibly damaging Het
Epcam T C 17: 87,640,474 V124A probably damaging Het
Erbb2 T A 11: 98,428,953 C624S probably damaging Het
Fam135b T A 15: 71,452,404 H1238L probably damaging Het
Fam90a1a A G 8: 21,963,697 D356G probably benign Het
Fbrsl1 G A 5: 110,376,439 S127L probably benign Het
Fndc3c1 C T X: 106,420,705 E1276K probably benign Het
Gbe1 A T 16: 70,569,041 N702I probably damaging Het
Gm10643 A T 8: 84,064,424 C20* probably null Het
Gpr156 A G 16: 37,997,908 N322S possibly damaging Het
Gsdma T A 11: 98,673,694 I333N probably damaging Het
Gstm1 A G 3: 108,014,811 F170S probably damaging Het
Hgsnat C T 8: 25,945,252 W618* probably null Het
Htr5a G A 5: 27,850,889 V293M possibly damaging Het
Hyal4 A G 6: 24,756,311 E176G probably benign Het
Jag1 T C 2: 137,090,938 D546G probably damaging Het
Kbtbd3 A G 9: 4,330,760 E378G probably benign Het
Lipo4 A G 19: 33,514,301 V94A probably damaging Het
Magea10 A T X: 72,382,773 I205K probably benign Het
Manea A G 4: 26,327,871 L390P probably damaging Het
Mars T A 10: 127,300,478 K493* probably null Het
Mars T C 10: 127,302,871 I439V probably benign Het
Mboat2 A G 12: 24,946,673 D225G possibly damaging Het
Mcmbp T A 7: 128,709,163 E350V probably damaging Het
Mki67 A G 7: 135,705,770 M459T probably benign Het
Mlf1 G A 3: 67,395,291 G150R probably damaging Het
Mtmr14 A G 6: 113,277,924 D294G probably null Het
Nlrp4e A C 7: 23,321,246 Y386S probably benign Het
Nomo1 A G 7: 46,033,944 D38G possibly damaging Het
Nudcd2 T C 11: 40,734,017 W18R probably damaging Het
Olfr1140 T C 2: 87,746,972 Y259H probably damaging Het
Olfr1155 G A 2: 87,943,146 L161F probably benign Het
Olfr401 A G 11: 74,121,580 Y97C probably benign Het
Olfr677 G T 7: 105,056,905 V220L probably benign Het
Olfr742 T A 14: 50,515,356 C51S probably benign Het
Pkd1 T C 17: 24,573,014 V1225A probably damaging Het
Plekhh2 T A 17: 84,606,877 L1236Q possibly damaging Het
Ppp2r1b A G 9: 50,883,585 D570G probably damaging Het
Prrc2c T A 1: 162,704,918 probably benign Het
Rai14 C T 15: 10,594,981 probably null Het
Rap1gap2 A G 11: 74,395,833 L547P probably benign Het
Rims3 A T 4: 120,891,358 M259L probably benign Het
Rsbn1l G A 5: 20,902,370 H549Y probably damaging Het
Sart3 A C 5: 113,747,921 probably null Het
Scn7a C A 2: 66,683,269 G1156C probably damaging Het
Sh3rf2 T A 18: 42,141,083 V406D probably damaging Het
Slitrk6 T C 14: 110,751,823 I151V probably damaging Het
Smarca2 A T 19: 26,631,093 Q260L probably benign Het
Smco1 A G 16: 32,273,840 R110G probably damaging Het
Spef2 T A 15: 9,668,903 probably null Het
Stab1 T A 14: 31,162,153 K219* probably null Het
Sulf1 G T 1: 12,858,834 E869* probably null Het
Susd1 T C 4: 59,349,925 I504V probably benign Het
Szt2 A G 4: 118,375,727 probably null Het
Tas1r3 A T 4: 155,862,920 C103S probably damaging Het
Thg1l C A 11: 45,950,203 W243L possibly damaging Het
Tlr4 A T 4: 66,840,470 D500V probably damaging Het
Tmem72 A G 6: 116,716,564 V5A probably benign Het
Tns4 T G 11: 99,085,703 M131L probably benign Het
Trim66 C T 7: 109,484,577 probably null Het
Ttll6 T A 11: 96,139,775 probably null Het
Ttn A T 2: 76,969,703 I387N probably damaging Het
Ubqln5 T A 7: 104,128,741 Q292L probably damaging Het
Vmn1r74 G T 7: 11,847,375 V201F probably damaging Het
Vmn2r28 G T 7: 5,488,314 D311E possibly damaging Het
Vtn T A 11: 78,499,716 V67E probably damaging Het
Xirp2 T A 2: 67,509,049 F545I probably damaging Het
Other mutations in Pcnx2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00898:Pcnx2 APN 8 125887585 missense probably damaging 1.00
IGL00900:Pcnx2 APN 8 125863236 splice site probably benign
IGL01134:Pcnx2 APN 8 125863150 missense probably benign
IGL01370:Pcnx2 APN 8 125801483 missense probably damaging 0.96
IGL01452:Pcnx2 APN 8 125838032 missense probably damaging 1.00
IGL01477:Pcnx2 APN 8 125785305 missense probably damaging 1.00
IGL01610:Pcnx2 APN 8 125839633 missense possibly damaging 0.67
IGL01640:Pcnx2 APN 8 125801558 missense probably benign 0.14
IGL01645:Pcnx2 APN 8 125887917 missense probably damaging 1.00
IGL01876:Pcnx2 APN 8 125866031 missense probably benign 0.31
IGL01933:Pcnx2 APN 8 125761654 missense probably damaging 1.00
IGL02208:Pcnx2 APN 8 125752155 missense probably benign 0.30
IGL02573:Pcnx2 APN 8 125855273 missense probably benign 0.34
IGL02810:Pcnx2 APN 8 125887203 missense probably benign 0.03
IGL02859:Pcnx2 APN 8 125863173 missense probably damaging 1.00
IGL02879:Pcnx2 APN 8 125772057 missense probably damaging 1.00
IGL03202:Pcnx2 APN 8 125772044 missense probably damaging 0.98
IGL03259:Pcnx2 APN 8 125753649 missense probably benign 0.19
IGL03395:Pcnx2 APN 8 125887523 missense probably benign 0.00
IGL03410:Pcnx2 APN 8 125887040 missense probably damaging 1.00
R0107:Pcnx2 UTSW 8 125753586 missense probably benign 0.29
R0477:Pcnx2 UTSW 8 125761567 missense probably damaging 0.99
R0610:Pcnx2 UTSW 8 125839687 missense probably damaging 1.00
R0645:Pcnx2 UTSW 8 125760720 missense possibly damaging 0.64
R0894:Pcnx2 UTSW 8 125886926 splice site probably benign
R1083:Pcnx2 UTSW 8 125772104 missense probably damaging 1.00
R1199:Pcnx2 UTSW 8 125887314 missense possibly damaging 0.60
R1296:Pcnx2 UTSW 8 125773833 missense probably damaging 1.00
R1445:Pcnx2 UTSW 8 125752284 missense probably damaging 0.99
R1467:Pcnx2 UTSW 8 125753550 missense possibly damaging 0.77
R1467:Pcnx2 UTSW 8 125753550 missense possibly damaging 0.77
R1524:Pcnx2 UTSW 8 125891141 missense probably benign 0.00
R1537:Pcnx2 UTSW 8 125877449 missense possibly damaging 0.94
R1574:Pcnx2 UTSW 8 125773930 missense probably damaging 1.00
R1574:Pcnx2 UTSW 8 125773930 missense probably damaging 1.00
R1593:Pcnx2 UTSW 8 125759273 missense probably benign 0.11
R1598:Pcnx2 UTSW 8 125772086 missense probably benign 0.03
R1603:Pcnx2 UTSW 8 125839626 missense probably damaging 1.00
R1697:Pcnx2 UTSW 8 125850348 missense probably damaging 1.00
R1759:Pcnx2 UTSW 8 125773978 missense probably damaging 1.00
R1855:Pcnx2 UTSW 8 125807996 splice site probably benign
R1863:Pcnx2 UTSW 8 125818786 missense probably damaging 0.98
R1930:Pcnx2 UTSW 8 125887714 missense probably benign 0.10
R1967:Pcnx2 UTSW 8 125815683 missense possibly damaging 0.51
R1974:Pcnx2 UTSW 8 125887371 missense probably benign 0.00
R2034:Pcnx2 UTSW 8 125818667 critical splice donor site probably null
R2072:Pcnx2 UTSW 8 125761742 missense possibly damaging 0.90
R2096:Pcnx2 UTSW 8 125759248 missense probably benign 0.27
R2216:Pcnx2 UTSW 8 125888077 missense probably benign 0.00
R2290:Pcnx2 UTSW 8 125877595 splice site probably benign
R2373:Pcnx2 UTSW 8 125753451 missense probably damaging 1.00
R2484:Pcnx2 UTSW 8 125891120 missense probably damaging 1.00
R2849:Pcnx2 UTSW 8 125760927 missense probably damaging 1.00
R2891:Pcnx2 UTSW 8 125891058 missense probably damaging 1.00
R2892:Pcnx2 UTSW 8 125891058 missense probably damaging 1.00
R2970:Pcnx2 UTSW 8 125801536 missense probably damaging 1.00
R3013:Pcnx2 UTSW 8 125887770 missense probably benign 0.05
R3608:Pcnx2 UTSW 8 125888101 missense probably benign
R3876:Pcnx2 UTSW 8 125888158 missense probably benign
R4349:Pcnx2 UTSW 8 125762851 missense probably damaging 0.98
R4352:Pcnx2 UTSW 8 125762851 missense probably damaging 0.98
R4353:Pcnx2 UTSW 8 125762851 missense probably damaging 0.98
R4361:Pcnx2 UTSW 8 125768298 nonsense probably null
R4735:Pcnx2 UTSW 8 125828041 critical splice donor site probably null
R4749:Pcnx2 UTSW 8 125887588 missense probably damaging 1.00
R4812:Pcnx2 UTSW 8 125865939 missense probably benign 0.00
R4819:Pcnx2 UTSW 8 125855230 missense probably benign 0.04
R4829:Pcnx2 UTSW 8 125861058 intron probably null
R4832:Pcnx2 UTSW 8 125752188 missense probably damaging 0.99
R4876:Pcnx2 UTSW 8 125772108 missense probably damaging 1.00
R4974:Pcnx2 UTSW 8 125851130 missense probably benign 0.00
R5057:Pcnx2 UTSW 8 125855191 missense possibly damaging 0.95
R5078:Pcnx2 UTSW 8 125752156 missense probably benign
R5114:Pcnx2 UTSW 8 125838010 missense possibly damaging 0.89
R5195:Pcnx2 UTSW 8 125801549 missense possibly damaging 0.69
R5239:Pcnx2 UTSW 8 125861082 intron probably null
R5348:Pcnx2 UTSW 8 125818756 missense probably damaging 1.00
R5398:Pcnx2 UTSW 8 125887948 missense possibly damaging 0.63
R5448:Pcnx2 UTSW 8 125888149 missense probably benign 0.14
R5534:Pcnx2 UTSW 8 125838015 missense possibly damaging 0.65
R5624:Pcnx2 UTSW 8 125761523 critical splice donor site probably null
R5629:Pcnx2 UTSW 8 125898041 missense probably damaging 1.00
R5630:Pcnx2 UTSW 8 125860958 missense probably damaging 0.99
R5782:Pcnx2 UTSW 8 125753484 missense probably damaging 1.00
R5877:Pcnx2 UTSW 8 125753728 missense probably damaging 0.99
R5879:Pcnx2 UTSW 8 125773946 missense probably damaging 1.00
R6114:Pcnx2 UTSW 8 125773947 missense probably damaging 1.00
R6152:Pcnx2 UTSW 8 125753752 missense probably damaging 0.99
R6154:Pcnx2 UTSW 8 125762813 missense probably damaging 1.00
R6283:Pcnx2 UTSW 8 125877586 missense probably damaging 0.99
R6500:Pcnx2 UTSW 8 125753485 missense probably damaging 1.00
R6629:Pcnx2 UTSW 8 125891112 missense probably benign 0.00
R6708:Pcnx2 UTSW 8 125860953 critical splice donor site probably null
R6736:Pcnx2 UTSW 8 125752317 splice site probably null
R6748:Pcnx2 UTSW 8 125850335 missense probably damaging 1.00
R6788:Pcnx2 UTSW 8 125772100 missense probably damaging 1.00
R6849:Pcnx2 UTSW 8 125861210 missense probably damaging 1.00
R6947:Pcnx2 UTSW 8 125850282 critical splice donor site probably null
R7034:Pcnx2 UTSW 8 125785302 missense probably damaging 1.00
R7100:Pcnx2 UTSW 8 125759114 missense probably benign 0.16
R7124:Pcnx2 UTSW 8 125753617 missense probably damaging 0.99
R7130:Pcnx2 UTSW 8 125753584 nonsense probably null
R7133:Pcnx2 UTSW 8 125801504 missense probably benign 0.01
Z1088:Pcnx2 UTSW 8 125826928 missense probably damaging 1.00
Z1088:Pcnx2 UTSW 8 125866018 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGACTGACACCCCTGTTTTG -3'
(R):5'- AGAATGGAGGTGATGTCGCC -3'

Sequencing Primer
(F):5'- ACCCCTGTTTTGATGTCATTAGAGAG -3'
(R):5'- CGCCTGATCGTTGTTCTGGC -3'
Posted On2014-08-25