Incidental Mutation 'R2035:Il33'
ID224578
Institutional Source Beutler Lab
Gene Symbol Il33
Ensembl Gene ENSMUSG00000024810
Gene Nameinterleukin 33
SynonymsNF-HEV, Il-33, Il1f11, 9230117N10Rik
MMRRC Submission 040042-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2035 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location29925114-29960718 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 29954637 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 143 (N143K)
Ref Sequence ENSEMBL: ENSMUSP00000135854 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025724] [ENSMUST00000120388] [ENSMUST00000136850] [ENSMUST00000144528] [ENSMUST00000177518]
Predicted Effect probably damaging
Transcript: ENSMUST00000025724
AA Change: N143K

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000025724
Gene: ENSMUSG00000024810
AA Change: N143K

DomainStartEndE-ValueType
Pfam:IL33 5 264 4.6e-146 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000120388
AA Change: N143K

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000113829
Gene: ENSMUSG00000024810
AA Change: N143K

DomainStartEndE-ValueType
Pfam:IL33 5 264 3.4e-129 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136850
SMART Domains Protein: ENSMUSP00000135324
Gene: ENSMUSG00000024810

DomainStartEndE-ValueType
Pfam:IL33 7 83 1.2e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144528
SMART Domains Protein: ENSMUSP00000122319
Gene: ENSMUSG00000024810

DomainStartEndE-ValueType
Pfam:IL33 5 66 2.4e-36 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000177518
AA Change: N143K

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000135854
Gene: ENSMUSG00000024810
AA Change: N143K

DomainStartEndE-ValueType
Pfam:IL33 5 228 4.1e-115 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cytokine that binds to the IL1RL1/ST2 receptor. The encoded protein is involved in the maturation of Th2 cells and the activation of mast cells, basophils, eosinophils and natural killer cells. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2015]
PHENOTYPE: Nullizygous mutations lead to altered Type 2 immunity and increased susceptibility to parasite infection. Homozygotes for a null allele show accelerated ovarian functional decline and early reproductive aging due to impaired migration of ovarian macrophages and failed disposal of atretic follicles. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik T C 13: 77,612,642 *1273Q probably null Het
2810474O19Rik G A 6: 149,329,226 V1257I possibly damaging Het
Aars2 A G 17: 45,514,801 I348V possibly damaging Het
Abca8b G A 11: 109,957,106 R788C possibly damaging Het
Abhd15 T C 11: 77,515,710 L171P probably damaging Het
Abi3bp A T 16: 56,660,218 H686L probably benign Het
Acsl1 A G 8: 46,528,584 Y456C probably damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Ash1l T A 3: 89,066,317 V2561D probably benign Het
B3galnt2 T A 13: 13,966,324 F44I probably benign Het
Bicra A T 7: 15,996,413 H24Q possibly damaging Het
Ccdc163 T C 4: 116,711,333 S195P probably damaging Het
Cd163 A T 6: 124,320,629 K911N probably damaging Het
Clcn3 A T 8: 60,934,598 S179T probably damaging Het
Dctn4 T A 18: 60,538,417 D120E possibly damaging Het
Dgcr14 A G 16: 17,910,086 probably null Het
Dnali1 C T 4: 125,059,110 V207M probably damaging Het
Dnhd1 A G 7: 105,704,921 Q3036R probably damaging Het
Dst G A 1: 34,271,413 R4098H probably damaging Het
Eml5 A T 12: 98,794,266 N1741K probably benign Het
Enah G A 1: 181,921,972 P415L probably damaging Het
F8 ATCTCTCTC ATCTCTC X: 75,322,998 probably null Het
Gm4841 T G 18: 60,269,857 Y388S probably benign Het
Grin3a T C 4: 49,771,336 T479A probably damaging Het
Gucy2e C A 11: 69,227,532 V743L probably benign Het
Ism1 T A 2: 139,757,155 S349R probably damaging Het
Itgb2 T A 10: 77,547,199 D134E probably damaging Het
Kcnk1 A C 8: 126,025,369 N238T possibly damaging Het
Kcnu1 G T 8: 25,896,693 V535L probably benign Het
Muc19 T A 15: 91,892,405 noncoding transcript Het
Mycbp2 A T 14: 103,260,239 Y966N probably damaging Het
Myo19 A T 11: 84,897,608 M349L probably benign Het
Narf G A 11: 121,238,500 A37T probably benign Het
Ncapd2 T C 6: 125,184,528 N208D probably benign Het
Nr1i2 A G 16: 38,251,126 probably null Het
Olfr1354 T C 10: 78,917,587 V249A possibly damaging Het
Olfr596 T A 7: 103,310,256 H178Q probably damaging Het
Opn5 A G 17: 42,607,161 I70T probably damaging Het
Pkn2 G T 3: 142,820,587 P410T probably damaging Het
Pla2r1 T C 2: 60,422,736 N1337S probably damaging Het
Prkd3 A T 17: 78,975,373 probably null Het
Pum2 T A 12: 8,728,638 Y429* probably null Het
Rttn T A 18: 89,020,216 V812E probably damaging Het
Rufy2 T A 10: 63,006,747 L483H probably damaging Het
Sdccag3 T A 2: 26,383,627 S374C probably damaging Het
Slc35a3 T A 3: 116,687,323 Q97L probably damaging Het
St18 A T 1: 6,802,328 M96L probably benign Het
Strc G A 2: 121,374,934 A905V probably damaging Het
Syne3 T C 12: 104,958,127 M338V probably benign Het
Syngr2 A G 11: 117,813,360 D187G probably benign Het
Tas2r109 A C 6: 132,980,460 I169R probably benign Het
Tbc1d22a T A 15: 86,391,065 probably null Het
Thbs1 T A 2: 118,118,340 probably null Het
Them6 C A 15: 74,721,675 D127E probably damaging Het
Tmem132d T C 5: 127,792,458 D604G probably damaging Het
Tnni1 A G 1: 135,805,592 T51A probably benign Het
Topors T C 4: 40,262,879 N135S probably damaging Het
Unc80 A T 1: 66,606,593 D1476V probably damaging Het
Vmn1r17 A G 6: 57,360,588 V264A probably benign Het
Vmn1r193 T A 13: 22,219,562 T87S probably benign Het
Vmn1r202 C A 13: 22,501,602 R215L probably damaging Het
Vmn2r24 A T 6: 123,816,060 N782I probably damaging Het
Vmn2r53 A G 7: 12,598,511 F404L possibly damaging Het
Xpo4 A T 14: 57,585,926 C1036S possibly damaging Het
Yae1d1 T C 13: 17,989,721 N104D probably benign Het
Zan C A 5: 137,443,947 R1901L unknown Het
Zbtb9 G A 17: 26,974,923 R434H probably damaging Het
Zdhhc23 A C 16: 43,973,508 C268G probably damaging Het
Other mutations in Il33
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01310:Il33 APN 19 29952756 missense probably benign 0.00
IGL01531:Il33 APN 19 29951981 missense possibly damaging 0.71
IGL01627:Il33 APN 19 29951990 missense possibly damaging 0.95
IGL02535:Il33 APN 19 29952747 missense probably benign 0.04
lacquer UTSW 19 29951990 missense possibly damaging 0.95
R0548:Il33 UTSW 19 29954647 missense probably benign 0.37
R0557:Il33 UTSW 19 29954636 missense probably damaging 0.98
R1511:Il33 UTSW 19 29955215 missense probably damaging 1.00
R1512:Il33 UTSW 19 29951990 missense possibly damaging 0.95
R1993:Il33 UTSW 19 29956904 missense possibly damaging 0.96
R1994:Il33 UTSW 19 29956904 missense possibly damaging 0.96
R4779:Il33 UTSW 19 29958911 nonsense probably null
R6429:Il33 UTSW 19 29952000 missense probably benign 0.16
R6498:Il33 UTSW 19 29949737 missense probably benign
R6879:Il33 UTSW 19 29958962 missense probably damaging 0.98
X0025:Il33 UTSW 19 29954612 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CACCCTGGTATCAGCTATGGTAC -3'
(R):5'- TGAGACCTTCTTGACATAGGAAG -3'

Sequencing Primer
(F):5'- GTTACAATGACAAAGTAGAGCTCAC -3'
(R):5'- CCACTGTTGATAACTTGGTAG -3'
Posted On2014-08-25