Incidental Mutation 'R1998:Amh'
List |< first << previous [record 77 of 1259] next >> last >|
ID224579
Institutional Source Beutler Lab
Gene Symbol Amh
Ensembl Gene ENSMUSG00000035262
Gene Nameanti-Mullerian hormone
SynonymsMIS, Mullerian inhibiting substance
MMRRC Submission 040008-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.505) question?
Stock #R1998 (G1)
Quality Score131
Status Not validated
Chromosome10
Chromosomal Location80805243-80807648 bp(+) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) AGCGCCTTGG to AG at 80805585 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000043153 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020435] [ENSMUST00000036016] [ENSMUST00000147440] [ENSMUST00000148665] [ENSMUST00000151928] [ENSMUST00000180438] [ENSMUST00000181039] [ENSMUST00000181945]
Predicted Effect probably benign
Transcript: ENSMUST00000020435
SMART Domains Protein: ENSMUSP00000020435
Gene: ENSMUSG00000020216

DomainStartEndE-ValueType
low complexity region 52 77 N/A INTRINSIC
Pfam:JSRP 79 138 1e-29 PFAM
low complexity region 145 158 N/A INTRINSIC
low complexity region 179 192 N/A INTRINSIC
low complexity region 205 230 N/A INTRINSIC
low complexity region 273 284 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000036016
SMART Domains Protein: ENSMUSP00000043153
Gene: ENSMUSG00000035262

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
low complexity region 38 52 N/A INTRINSIC
Pfam:AMH_N 75 439 3e-133 PFAM
TGFB 456 554 8.57e-36 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139461
Predicted Effect probably benign
Transcript: ENSMUST00000147440
SMART Domains Protein: ENSMUSP00000116478
Gene: ENSMUSG00000020211

DomainStartEndE-ValueType
low complexity region 18 36 N/A INTRINSIC
Blast:CactinC_cactus 41 67 1e-9 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000148665
SMART Domains Protein: ENSMUSP00000117160
Gene: ENSMUSG00000020211

DomainStartEndE-ValueType
low complexity region 18 36 N/A INTRINSIC
ZnF_U1 51 85 5.02e-9 SMART
ZnF_C2H2 54 78 1.23e1 SMART
CactinC_cactus 91 219 8.29e-35 SMART
low complexity region 300 318 N/A INTRINSIC
low complexity region 320 420 N/A INTRINSIC
low complexity region 423 452 N/A INTRINSIC
low complexity region 459 484 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000151928
SMART Domains Protein: ENSMUSP00000114164
Gene: ENSMUSG00000020211

DomainStartEndE-ValueType
low complexity region 18 36 N/A INTRINSIC
ZnF_U1 51 85 5.02e-9 SMART
ZnF_C2H2 54 78 1.23e1 SMART
CactinC_cactus 91 194 1.26e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000180438
SMART Domains Protein: ENSMUSP00000137701
Gene: ENSMUSG00000020216

DomainStartEndE-ValueType
low complexity region 23 48 N/A INTRINSIC
Pfam:JSRP 49 78 3.2e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000181039
SMART Domains Protein: ENSMUSP00000137666
Gene: ENSMUSG00000020216

DomainStartEndE-ValueType
low complexity region 92 117 N/A INTRINSIC
Pfam:JSRP 118 179 1e-31 PFAM
low complexity region 185 198 N/A INTRINSIC
low complexity region 219 232 N/A INTRINSIC
low complexity region 245 270 N/A INTRINSIC
low complexity region 313 324 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000181945
SMART Domains Protein: ENSMUSP00000137960
Gene: ENSMUSG00000020216

DomainStartEndE-ValueType
transmembrane domain 53 75 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate N- and C-terminal cleavage products that homodimerize and associate to form a biologically active noncovalent complex. This complex binds to the anti-Mullerian hormone receptor type 2 and causes the regression of Mullerian ducts in the male embryo that would otherwise differentiate into the uterus and fallopian tubes. This protein also plays a role in Leydig cell differentiation and function and follicular development in adult females. Homozygous knockout male mice develop female reproductive organs and are often sterile, while homozygous knockout female mice exhibit premature depletion of primordial follicles. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygous null mutant males have a complete male reproductive tract and functional sperm, but also uterus and oviducts. Most are infertile due to female organs blocking sperm transfer. Females are fertile with enlarged ovaries and atypical follicles. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik T G 5: 87,970,694 N12K probably damaging Het
2700049A03Rik T A 12: 71,188,619 S1114R possibly damaging Het
4931409K22Rik G A 5: 24,545,006 R680C probably benign Het
Acot1 T A 12: 84,009,753 W82R probably damaging Het
Adam22 T C 5: 8,329,995 D101G probably damaging Het
Adcy9 T C 16: 4,297,412 D705G probably benign Het
Adgrg3 T G 8: 95,036,668 L244V probably damaging Het
Brinp1 C T 4: 68,762,553 G580E probably damaging Het
Brwd1 G A 16: 96,021,288 T1239M probably damaging Het
Camk1d A T 2: 5,362,025 Y126* probably null Het
Camta1 T C 4: 151,077,880 Y1560C probably damaging Het
Cbfa2t2 T A 2: 154,504,789 L139M probably damaging Het
Cd226 T C 18: 89,207,219 V80A probably damaging Het
Dgka C T 10: 128,729,939 V367I probably benign Het
Dnajb13 A T 7: 100,504,610 I206N probably benign Het
Dst A T 1: 34,256,347 Q5693L probably damaging Het
Ear6 T A 14: 51,854,215 I73N probably benign Het
Egr1 A G 18: 34,861,534 I16V probably benign Het
Eif2s1 T A 12: 78,866,734 C70S possibly damaging Het
Epcam T C 17: 87,640,474 V124A probably damaging Het
Erbb2 T A 11: 98,428,953 C624S probably damaging Het
Fam135b T A 15: 71,452,404 H1238L probably damaging Het
Fam90a1a A G 8: 21,963,697 D356G probably benign Het
Fbrsl1 G A 5: 110,376,439 S127L probably benign Het
Fndc3c1 C T X: 106,420,705 E1276K probably benign Het
Gbe1 A T 16: 70,569,041 N702I probably damaging Het
Gm10643 A T 8: 84,064,424 C20* probably null Het
Gpr156 A G 16: 37,997,908 N322S possibly damaging Het
Gsdma T A 11: 98,673,694 I333N probably damaging Het
Gstm1 A G 3: 108,014,811 F170S probably damaging Het
Hgsnat C T 8: 25,945,252 W618* probably null Het
Htr5a G A 5: 27,850,889 V293M possibly damaging Het
Hyal4 A G 6: 24,756,311 E176G probably benign Het
Jag1 T C 2: 137,090,938 D546G probably damaging Het
Kbtbd3 A G 9: 4,330,760 E378G probably benign Het
Lipo4 A G 19: 33,514,301 V94A probably damaging Het
Magea10 A T X: 72,382,773 I205K probably benign Het
Manea A G 4: 26,327,871 L390P probably damaging Het
Mars T A 10: 127,300,478 K493* probably null Het
Mars T C 10: 127,302,871 I439V probably benign Het
Mboat2 A G 12: 24,946,673 D225G possibly damaging Het
Mcmbp T A 7: 128,709,163 E350V probably damaging Het
Mki67 A G 7: 135,705,770 M459T probably benign Het
Mlf1 G A 3: 67,395,291 G150R probably damaging Het
Mtmr14 A G 6: 113,277,924 D294G probably null Het
Nlrp4e A C 7: 23,321,246 Y386S probably benign Het
Nomo1 A G 7: 46,033,944 D38G possibly damaging Het
Nudcd2 T C 11: 40,734,017 W18R probably damaging Het
Olfr1140 T C 2: 87,746,972 Y259H probably damaging Het
Olfr1155 G A 2: 87,943,146 L161F probably benign Het
Olfr401 A G 11: 74,121,580 Y97C probably benign Het
Olfr677 G T 7: 105,056,905 V220L probably benign Het
Olfr742 T A 14: 50,515,356 C51S probably benign Het
Pcnx2 A T 8: 125,887,143 V523D probably damaging Het
Pkd1 T C 17: 24,573,014 V1225A probably damaging Het
Plekhh2 T A 17: 84,606,877 L1236Q possibly damaging Het
Ppp2r1b A G 9: 50,883,585 D570G probably damaging Het
Prrc2c T A 1: 162,704,918 probably benign Het
Rai14 C T 15: 10,594,981 probably null Het
Rap1gap2 A G 11: 74,395,833 L547P probably benign Het
Rims3 A T 4: 120,891,358 M259L probably benign Het
Rsbn1l G A 5: 20,902,370 H549Y probably damaging Het
Sart3 A C 5: 113,747,921 probably null Het
Scn7a C A 2: 66,683,269 G1156C probably damaging Het
Sh3rf2 T A 18: 42,141,083 V406D probably damaging Het
Slitrk6 T C 14: 110,751,823 I151V probably damaging Het
Smarca2 A T 19: 26,631,093 Q260L probably benign Het
Smco1 A G 16: 32,273,840 R110G probably damaging Het
Spef2 T A 15: 9,668,903 probably null Het
Stab1 T A 14: 31,162,153 K219* probably null Het
Sulf1 G T 1: 12,858,834 E869* probably null Het
Susd1 T C 4: 59,349,925 I504V probably benign Het
Szt2 A G 4: 118,375,727 probably null Het
Tas1r3 A T 4: 155,862,920 C103S probably damaging Het
Thg1l C A 11: 45,950,203 W243L possibly damaging Het
Tlr4 A T 4: 66,840,470 D500V probably damaging Het
Tmem72 A G 6: 116,716,564 V5A probably benign Het
Tns4 T G 11: 99,085,703 M131L probably benign Het
Trim66 C T 7: 109,484,577 probably null Het
Ttll6 T A 11: 96,139,775 probably null Het
Ttn A T 2: 76,969,703 I387N probably damaging Het
Ubqln5 T A 7: 104,128,741 Q292L probably damaging Het
Vmn1r74 G T 7: 11,847,375 V201F probably damaging Het
Vmn2r28 G T 7: 5,488,314 D311E possibly damaging Het
Vtn T A 11: 78,499,716 V67E probably damaging Het
Xirp2 T A 2: 67,509,049 F545I probably damaging Het
Other mutations in Amh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02026:Amh APN 10 80805408 missense probably damaging 0.98
R0553:Amh UTSW 10 80806176 unclassified probably benign
R1195:Amh UTSW 10 80805585 frame shift probably null
R1195:Amh UTSW 10 80805585 frame shift probably null
R1750:Amh UTSW 10 80805585 frame shift probably null
R1765:Amh UTSW 10 80805585 frame shift probably null
R1974:Amh UTSW 10 80806416 missense probably benign 0.00
R4425:Amh UTSW 10 80806921 missense probably damaging 1.00
R4554:Amh UTSW 10 80807051 missense probably benign
R6007:Amh UTSW 10 80805471 missense probably benign
R6989:Amh UTSW 10 80805504 missense probably benign
Predicted Primers PCR Primer
(F):5'- AACCTTTGTGCCTGGTGAC -3'
(R):5'- GCCCACTACAGTTCCTGAAAG -3'

Sequencing Primer
(F):5'- TGGTGACAGTGAGAGGAGAG -3'
(R):5'- GGTTCTGCCTAGCAATCCAG -3'
Posted On2014-08-25