Incidental Mutation 'R2036:Helz2'
ID224598
Institutional Source Beutler Lab
Gene Symbol Helz2
Ensembl Gene ENSMUSG00000027580
Gene Namehelicase with zinc finger 2, transcriptional coactivator
SynonymsBC006779
MMRRC Submission 040043-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2036 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location181227615-181242027 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 181237479 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 782 (H782L)
Ref Sequence ENSEMBL: ENSMUSP00000112917 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094203] [ENSMUST00000108831] [ENSMUST00000121484]
Predicted Effect probably benign
Transcript: ENSMUST00000094203
AA Change: H782L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000091756
Gene: ENSMUSG00000027580
AA Change: H782L

DomainStartEndE-ValueType
low complexity region 509 517 N/A INTRINSIC
AAA 782 973 1.41e-2 SMART
low complexity region 1238 1263 N/A INTRINSIC
low complexity region 1284 1291 N/A INTRINSIC
RNB 1567 1924 2.45e-87 SMART
low complexity region 2056 2067 N/A INTRINSIC
low complexity region 2242 2259 N/A INTRINSIC
AAA 2462 2713 1.48e0 SMART
SCOP:d1pjr_2 2793 2838 2e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108831
AA Change: H782L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000104459
Gene: ENSMUSG00000027580
AA Change: H782L

DomainStartEndE-ValueType
low complexity region 509 517 N/A INTRINSIC
AAA 782 973 1.41e-2 SMART
low complexity region 1238 1263 N/A INTRINSIC
low complexity region 1284 1291 N/A INTRINSIC
RNB 1567 1924 2.45e-87 SMART
low complexity region 2056 2067 N/A INTRINSIC
low complexity region 2242 2259 N/A INTRINSIC
AAA 2462 2713 1.48e0 SMART
SCOP:d1pjr_2 2793 2838 2e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000121484
AA Change: H782L

PolyPhen 2 Score 0.034 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000112917
Gene: ENSMUSG00000027580
AA Change: H782L

DomainStartEndE-ValueType
low complexity region 509 517 N/A INTRINSIC
Pfam:AAA_11 761 877 3.9e-10 PFAM
Pfam:AAA_19 780 849 1.7e-7 PFAM
Pfam:AAA_11 870 952 2e-15 PFAM
Pfam:AAA_12 958 1162 3.8e-26 PFAM
low complexity region 1238 1263 N/A INTRINSIC
low complexity region 1284 1291 N/A INTRINSIC
RNB 1567 1924 2.45e-87 SMART
low complexity region 2056 2067 N/A INTRINSIC
low complexity region 2242 2259 N/A INTRINSIC
Pfam:AAA_11 2400 2653 4e-42 PFAM
Pfam:AAA_12 2660 2866 2e-47 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149417
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155049
Meta Mutation Damage Score 0.0508 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a nuclear transcriptional co-activator for peroxisome proliferator activated receptor alpha. The encoded protein contains a zinc finger and is a helicase that appears to be part of the peroxisome proliferator activated receptor alpha interacting complex. This gene is a member of the DNA2/NAM7 helicase gene family. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit slower weight gain, hyperleptinemia, increased oxygen consumption, decreased respiratory quotient, decreased liver triglyceride level and ameliorated hyperlipidemia and hepatosteatosis when fed a high-fat diet. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik A G 1: 105,743,254 D1029G probably damaging Het
4930415H17Rik C T 11: 99,685,532 C3Y unknown Het
Abr G T 11: 76,452,350 T547K probably benign Het
Akr1c21 T C 13: 4,576,306 Y110H probably damaging Het
Ankar T A 1: 72,666,530 K556* probably null Het
Anks1b T C 10: 90,969,853 V431A probably damaging Het
Ap5b1 T C 19: 5,568,869 S106P possibly damaging Het
Arhgap17 T C 7: 123,318,494 N156D possibly damaging Het
Arhgap35 T C 7: 16,563,133 E669G probably damaging Het
Arhgap44 T C 11: 65,041,492 M201V possibly damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Atg4c C T 4: 99,218,139 T112M possibly damaging Het
Bcl11a A T 11: 24,164,087 N477Y possibly damaging Het
Brinp3 A T 1: 146,701,841 I205F possibly damaging Het
Capza2 T C 6: 17,660,778 F159S probably damaging Het
Cd40 T C 2: 165,062,301 C61R probably benign Het
Cdc25c G C 18: 34,738,239 L275V probably damaging Het
Cdh23 A G 10: 60,466,043 I415T possibly damaging Het
Clnk A T 5: 38,752,800 probably null Het
Ctcfl C T 2: 173,101,985 R524Q possibly damaging Het
Cyb5r4 T G 9: 87,042,879 probably benign Het
Ddb1 T A 19: 10,610,822 probably benign Het
Ddx51 C A 5: 110,656,625 Q526K probably benign Het
Dennd6a A T 14: 26,608,119 Q56L probably damaging Het
Dhdds T C 4: 133,971,099 E142G probably damaging Het
Dnaic1 A G 4: 41,632,225 H553R probably damaging Het
Fryl T C 5: 73,022,544 N2908S probably benign Het
Fryl C A 5: 73,107,962 probably null Het
Fut9 A G 4: 25,620,322 I164T probably damaging Het
Gba2 G A 4: 43,568,118 probably benign Het
Gm11627 C T 11: 102,576,754 V33I unknown Het
Kcnmb3 A G 3: 32,472,382 V220A probably damaging Het
Kif20a T C 18: 34,628,462 S303P possibly damaging Het
Kif22 A T 7: 127,030,954 V470E possibly damaging Het
Majin C T 19: 6,213,312 T132M probably benign Het
Mboat7 A G 7: 3,685,672 probably null Het
Mkrn2 C A 6: 115,611,914 P206Q probably benign Het
Mphosph9 G A 5: 124,304,211 T358M probably damaging Het
Nkd1 A G 8: 88,591,677 D210G probably damaging Het
Olfr1215 C T 2: 89,001,632 V219I probably damaging Het
Olfr1287 T A 2: 111,449,626 L162Q possibly damaging Het
Olfr1411 A T 1: 92,596,606 E29V probably benign Het
Olfr1443 G C 19: 12,680,801 G231A probably damaging Het
Olfr291 G T 7: 84,856,358 probably benign Het
Olfr494 T A 7: 108,367,740 N83K probably benign Het
Olfr781 G A 10: 129,333,672 D264N probably benign Het
Pi4ka A G 16: 17,303,112 Y63H probably damaging Het
Plekha1 A G 7: 130,902,192 R210G probably damaging Het
Ppp2r2c C T 5: 36,952,404 T369I possibly damaging Het
Rmnd1 T C 10: 4,407,884 D12G probably damaging Het
Rtn2 A G 7: 19,293,739 K120E probably damaging Het
Sh3tc1 A G 5: 35,716,164 S30P probably benign Het
Tln2 T C 9: 67,272,704 E795G possibly damaging Het
Tmprss11d T A 5: 86,309,269 Y177F probably damaging Het
Trrap C A 5: 144,828,562 D2529E probably benign Het
Vmn2r58 A G 7: 41,863,993 Y409H probably benign Het
Wdr72 T A 9: 74,151,594 V323D probably damaging Het
Other mutations in Helz2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Helz2 APN 2 181229702 missense probably damaging 1.00
IGL00515:Helz2 APN 2 181233006 nonsense probably null
IGL00704:Helz2 APN 2 181234385 missense probably damaging 1.00
IGL00847:Helz2 APN 2 181232245 missense possibly damaging 0.73
IGL01448:Helz2 APN 2 181233977 missense probably damaging 1.00
IGL01783:Helz2 APN 2 181232881 missense probably damaging 1.00
IGL01790:Helz2 APN 2 181238481 missense probably benign 0.29
IGL02116:Helz2 APN 2 181232185 missense probably damaging 1.00
IGL02226:Helz2 APN 2 181231690 missense probably damaging 1.00
IGL02402:Helz2 APN 2 181230911 missense probably damaging 1.00
IGL02403:Helz2 APN 2 181231022 missense probably damaging 1.00
IGL02733:Helz2 APN 2 181235026 missense probably benign 0.14
IGL02869:Helz2 APN 2 181231146 intron probably benign
IGL03003:Helz2 APN 2 181240253 missense probably damaging 1.00
IGL03060:Helz2 APN 2 181229222 critical splice donor site probably null
IGL03310:Helz2 APN 2 181231804 missense probably benign 0.00
Colby UTSW 2 181233202 missense probably damaging 1.00
ANU74:Helz2 UTSW 2 181234834 missense probably benign 0.03
R0013:Helz2 UTSW 2 181232759 missense probably damaging 1.00
R0013:Helz2 UTSW 2 181240959 missense probably benign
R0014:Helz2 UTSW 2 181240511 missense probably damaging 1.00
R0014:Helz2 UTSW 2 181240511 missense probably damaging 1.00
R0016:Helz2 UTSW 2 181232759 missense probably damaging 1.00
R0018:Helz2 UTSW 2 181232759 missense probably damaging 1.00
R0019:Helz2 UTSW 2 181232759 missense probably damaging 1.00
R0019:Helz2 UTSW 2 181232759 missense probably damaging 1.00
R0055:Helz2 UTSW 2 181228821 missense possibly damaging 0.47
R0055:Helz2 UTSW 2 181228821 missense possibly damaging 0.47
R0071:Helz2 UTSW 2 181236407 missense probably damaging 1.00
R0071:Helz2 UTSW 2 181236407 missense probably damaging 1.00
R0111:Helz2 UTSW 2 181237802 missense probably benign 0.30
R0117:Helz2 UTSW 2 181232759 missense probably damaging 1.00
R0135:Helz2 UTSW 2 181232269 missense probably damaging 1.00
R0194:Helz2 UTSW 2 181232759 missense probably damaging 1.00
R0242:Helz2 UTSW 2 181230430 missense probably damaging 1.00
R0242:Helz2 UTSW 2 181230430 missense probably damaging 1.00
R0254:Helz2 UTSW 2 181232759 missense probably damaging 1.00
R0410:Helz2 UTSW 2 181230593 missense probably damaging 1.00
R0442:Helz2 UTSW 2 181232209 missense probably damaging 0.97
R0497:Helz2 UTSW 2 181229656 missense probably damaging 0.97
R0517:Helz2 UTSW 2 181227770 missense probably benign 0.00
R0541:Helz2 UTSW 2 181234825 missense possibly damaging 0.89
R0542:Helz2 UTSW 2 181232089 missense probably damaging 1.00
R0591:Helz2 UTSW 2 181232116 missense probably damaging 0.96
R0692:Helz2 UTSW 2 181240881 missense probably benign
R0826:Helz2 UTSW 2 181240853 missense possibly damaging 0.51
R0834:Helz2 UTSW 2 181230777 missense probably damaging 1.00
R0880:Helz2 UTSW 2 181236135 missense probably benign
R1170:Helz2 UTSW 2 181229815 missense probably damaging 1.00
R1186:Helz2 UTSW 2 181231128 missense probably damaging 1.00
R1344:Helz2 UTSW 2 181237596 missense possibly damaging 0.89
R1358:Helz2 UTSW 2 181232981 missense probably damaging 1.00
R1436:Helz2 UTSW 2 181235524 missense probably damaging 0.99
R1464:Helz2 UTSW 2 181239654 missense probably damaging 1.00
R1464:Helz2 UTSW 2 181239654 missense probably damaging 1.00
R1466:Helz2 UTSW 2 181236297 missense probably damaging 1.00
R1466:Helz2 UTSW 2 181236297 missense probably damaging 1.00
R1477:Helz2 UTSW 2 181232804 missense probably benign 0.00
R1564:Helz2 UTSW 2 181233228 missense probably benign 0.01
R1584:Helz2 UTSW 2 181236297 missense probably damaging 1.00
R1655:Helz2 UTSW 2 181234147 missense probably damaging 0.99
R1757:Helz2 UTSW 2 181236263 missense probably damaging 1.00
R1779:Helz2 UTSW 2 181234987 missense probably benign
R1779:Helz2 UTSW 2 181238459 missense possibly damaging 0.84
R1837:Helz2 UTSW 2 181229289 missense probably damaging 1.00
R1845:Helz2 UTSW 2 181232085 missense probably benign 0.02
R1894:Helz2 UTSW 2 181234289 missense probably damaging 1.00
R1913:Helz2 UTSW 2 181233750 missense probably damaging 1.00
R2005:Helz2 UTSW 2 181231329 missense probably benign 0.45
R2034:Helz2 UTSW 2 181232578 missense probably damaging 1.00
R2061:Helz2 UTSW 2 181240544 missense probably damaging 1.00
R2088:Helz2 UTSW 2 181235102 missense probably benign 0.07
R2142:Helz2 UTSW 2 181231380 missense probably benign
R2180:Helz2 UTSW 2 181233732 missense probably damaging 1.00
R2192:Helz2 UTSW 2 181229048 nonsense probably null
R2248:Helz2 UTSW 2 181233433 missense probably benign 0.33
R2495:Helz2 UTSW 2 181232912 missense probably damaging 0.99
R2886:Helz2 UTSW 2 181240742 missense probably benign
R3617:Helz2 UTSW 2 181233061 missense probably damaging 1.00
R3776:Helz2 UTSW 2 181240389 nonsense probably null
R3803:Helz2 UTSW 2 181239996 missense probably damaging 0.96
R4043:Helz2 UTSW 2 181229710 missense probably benign 0.00
R4052:Helz2 UTSW 2 181240475 missense probably damaging 1.00
R4232:Helz2 UTSW 2 181229902 missense probably damaging 1.00
R4521:Helz2 UTSW 2 181228833 missense probably benign
R4624:Helz2 UTSW 2 181239308 missense probably damaging 0.99
R4720:Helz2 UTSW 2 181238417 missense probably damaging 1.00
R4831:Helz2 UTSW 2 181237417 missense probably damaging 1.00
R4852:Helz2 UTSW 2 181230120 missense probably damaging 1.00
R4894:Helz2 UTSW 2 181236147 missense probably benign 0.01
R4915:Helz2 UTSW 2 181232438 missense possibly damaging 0.80
R4965:Helz2 UTSW 2 181240916 missense possibly damaging 0.79
R5022:Helz2 UTSW 2 181240569 missense probably benign
R5089:Helz2 UTSW 2 181235149 missense probably benign 0.14
R5190:Helz2 UTSW 2 181230757 critical splice donor site probably null
R5309:Helz2 UTSW 2 181234846 missense probably benign 0.08
R5358:Helz2 UTSW 2 181235528 missense probably damaging 1.00
R5379:Helz2 UTSW 2 181235069 missense probably benign
R5559:Helz2 UTSW 2 181230126 missense probably damaging 0.98
R5591:Helz2 UTSW 2 181240258 missense probably damaging 0.99
R5596:Helz2 UTSW 2 181237289 intron probably benign
R5805:Helz2 UTSW 2 181240508 missense probably damaging 1.00
R5823:Helz2 UTSW 2 181236396 missense possibly damaging 0.92
R5825:Helz2 UTSW 2 181232656 missense probably benign 0.02
R5873:Helz2 UTSW 2 181234028 missense possibly damaging 0.78
R5928:Helz2 UTSW 2 181230384 missense possibly damaging 0.82
R5936:Helz2 UTSW 2 181230767 missense probably damaging 1.00
R5975:Helz2 UTSW 2 181231050 missense probably benign 0.08
R6045:Helz2 UTSW 2 181240313 missense probably benign 0.03
R6077:Helz2 UTSW 2 181233038 missense probably benign 0.41
R6218:Helz2 UTSW 2 181232294 missense probably benign 0.03
R6218:Helz2 UTSW 2 181235945 missense probably damaging 1.00
R6315:Helz2 UTSW 2 181233202 missense probably damaging 1.00
R6346:Helz2 UTSW 2 181233467 missense probably damaging 1.00
R6371:Helz2 UTSW 2 181233467 missense probably damaging 1.00
R6372:Helz2 UTSW 2 181233467 missense probably damaging 1.00
R6373:Helz2 UTSW 2 181233467 missense probably damaging 1.00
R6385:Helz2 UTSW 2 181233467 missense probably damaging 1.00
R6464:Helz2 UTSW 2 181235069 missense probably benign
R6581:Helz2 UTSW 2 181229379 missense probably damaging 0.99
R6651:Helz2 UTSW 2 181239557 nonsense probably null
R6964:Helz2 UTSW 2 181230428 missense probably damaging 1.00
R7061:Helz2 UTSW 2 181240514 missense probably damaging 1.00
R7153:Helz2 UTSW 2 181231285 missense probably benign 0.00
X0064:Helz2 UTSW 2 181231741 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGAAAAGGAACCCATATCTCC -3'
(R):5'- TATGACCTTCCGGTTCTGGC -3'

Sequencing Primer
(F):5'- ATCAGAGAGATGGGTGCTCTG -3'
(R):5'- CTTCCGGTTCTGGCATCAGG -3'
Posted On2014-08-25