Incidental Mutation 'R1998:Rai14'
ID224630
Institutional Source Beutler Lab
Gene Symbol Rai14
Ensembl Gene ENSMUSG00000022246
Gene Nameretinoic acid induced 14
Synonyms1700008J19Rik, 1700020L11Rik, Ankycorbin, Norpeg
MMRRC Submission 040008-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.711) question?
Stock #R1998 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location10568969-10714624 bp(-) (GRCm38)
Type of Mutationsplice site (5 bp from exon)
DNA Base Change (assembly) C to T at 10594981 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000153969 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090339] [ENSMUST00000169385] [ENSMUST00000227506]
Predicted Effect probably null
Transcript: ENSMUST00000090339
SMART Domains Protein: ENSMUSP00000087815
Gene: ENSMUSG00000022246

DomainStartEndE-ValueType
Blast:ANK 18 48 4e-10 BLAST
ANK 52 81 1.66e-6 SMART
ANK 85 117 7.02e-5 SMART
ANK 118 147 2.1e-3 SMART
ANK 151 180 2.16e-5 SMART
ANK 184 213 2.85e-5 SMART
ANK 217 247 9.33e2 SMART
low complexity region 343 357 N/A INTRINSIC
Blast:HAMP 595 646 6e-19 BLAST
low complexity region 897 931 N/A INTRINSIC
Blast:ANK 944 977 6e-13 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000169385
SMART Domains Protein: ENSMUSP00000126325
Gene: ENSMUSG00000022246

DomainStartEndE-ValueType
Blast:ANK 18 48 4e-10 BLAST
ANK 52 81 1.66e-6 SMART
ANK 85 117 7.02e-5 SMART
ANK 118 147 2.1e-3 SMART
ANK 151 180 2.16e-5 SMART
ANK 184 213 2.85e-5 SMART
ANK 217 247 9.33e2 SMART
low complexity region 343 357 N/A INTRINSIC
Blast:HAMP 595 646 6e-19 BLAST
low complexity region 897 931 N/A INTRINSIC
Blast:ANK 944 977 6e-13 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226530
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226737
Predicted Effect probably null
Transcript: ENSMUST00000227506
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik T G 5: 87,970,694 N12K probably damaging Het
2700049A03Rik T A 12: 71,188,619 S1114R possibly damaging Het
4931409K22Rik G A 5: 24,545,006 R680C probably benign Het
Acot1 T A 12: 84,009,753 W82R probably damaging Het
Adam22 T C 5: 8,329,995 D101G probably damaging Het
Adcy9 T C 16: 4,297,412 D705G probably benign Het
Adgrg3 T G 8: 95,036,668 L244V probably damaging Het
Amh AGCGCCTTGG AG 10: 80,805,585 probably null Het
Brinp1 C T 4: 68,762,553 G580E probably damaging Het
Brwd1 G A 16: 96,021,288 T1239M probably damaging Het
Camk1d A T 2: 5,362,025 Y126* probably null Het
Camta1 T C 4: 151,077,880 Y1560C probably damaging Het
Cbfa2t2 T A 2: 154,504,789 L139M probably damaging Het
Cd226 T C 18: 89,207,219 V80A probably damaging Het
Dgka C T 10: 128,729,939 V367I probably benign Het
Dnajb13 A T 7: 100,504,610 I206N probably benign Het
Dst A T 1: 34,256,347 Q5693L probably damaging Het
Ear6 T A 14: 51,854,215 I73N probably benign Het
Egr1 A G 18: 34,861,534 I16V probably benign Het
Eif2s1 T A 12: 78,866,734 C70S possibly damaging Het
Epcam T C 17: 87,640,474 V124A probably damaging Het
Erbb2 T A 11: 98,428,953 C624S probably damaging Het
Fam135b T A 15: 71,452,404 H1238L probably damaging Het
Fam90a1a A G 8: 21,963,697 D356G probably benign Het
Fbrsl1 G A 5: 110,376,439 S127L probably benign Het
Fndc3c1 C T X: 106,420,705 E1276K probably benign Het
Gbe1 A T 16: 70,569,041 N702I probably damaging Het
Gm10643 A T 8: 84,064,424 C20* probably null Het
Gpr156 A G 16: 37,997,908 N322S possibly damaging Het
Gsdma T A 11: 98,673,694 I333N probably damaging Het
Gstm1 A G 3: 108,014,811 F170S probably damaging Het
Hgsnat C T 8: 25,945,252 W618* probably null Het
Htr5a G A 5: 27,850,889 V293M possibly damaging Het
Hyal4 A G 6: 24,756,311 E176G probably benign Het
Jag1 T C 2: 137,090,938 D546G probably damaging Het
Kbtbd3 A G 9: 4,330,760 E378G probably benign Het
Lipo4 A G 19: 33,514,301 V94A probably damaging Het
Magea10 A T X: 72,382,773 I205K probably benign Het
Manea A G 4: 26,327,871 L390P probably damaging Het
Mars T A 10: 127,300,478 K493* probably null Het
Mars T C 10: 127,302,871 I439V probably benign Het
Mboat2 A G 12: 24,946,673 D225G possibly damaging Het
Mcmbp T A 7: 128,709,163 E350V probably damaging Het
Mki67 A G 7: 135,705,770 M459T probably benign Het
Mlf1 G A 3: 67,395,291 G150R probably damaging Het
Mtmr14 A G 6: 113,277,924 D294G probably null Het
Nlrp4e A C 7: 23,321,246 Y386S probably benign Het
Nomo1 A G 7: 46,033,944 D38G possibly damaging Het
Nudcd2 T C 11: 40,734,017 W18R probably damaging Het
Olfr1140 T C 2: 87,746,972 Y259H probably damaging Het
Olfr1155 G A 2: 87,943,146 L161F probably benign Het
Olfr401 A G 11: 74,121,580 Y97C probably benign Het
Olfr677 G T 7: 105,056,905 V220L probably benign Het
Olfr742 T A 14: 50,515,356 C51S probably benign Het
Pcnx2 A T 8: 125,887,143 V523D probably damaging Het
Pkd1 T C 17: 24,573,014 V1225A probably damaging Het
Plekhh2 T A 17: 84,606,877 L1236Q possibly damaging Het
Ppp2r1b A G 9: 50,883,585 D570G probably damaging Het
Prrc2c T A 1: 162,704,918 probably benign Het
Rap1gap2 A G 11: 74,395,833 L547P probably benign Het
Rims3 A T 4: 120,891,358 M259L probably benign Het
Rsbn1l G A 5: 20,902,370 H549Y probably damaging Het
Sart3 A C 5: 113,747,921 probably null Het
Scn7a C A 2: 66,683,269 G1156C probably damaging Het
Sh3rf2 T A 18: 42,141,083 V406D probably damaging Het
Slitrk6 T C 14: 110,751,823 I151V probably damaging Het
Smarca2 A T 19: 26,631,093 Q260L probably benign Het
Smco1 A G 16: 32,273,840 R110G probably damaging Het
Spef2 T A 15: 9,668,903 probably null Het
Stab1 T A 14: 31,162,153 K219* probably null Het
Sulf1 G T 1: 12,858,834 E869* probably null Het
Susd1 T C 4: 59,349,925 I504V probably benign Het
Szt2 A G 4: 118,375,727 probably null Het
Tas1r3 A T 4: 155,862,920 C103S probably damaging Het
Thg1l C A 11: 45,950,203 W243L possibly damaging Het
Tlr4 A T 4: 66,840,470 D500V probably damaging Het
Tmem72 A G 6: 116,716,564 V5A probably benign Het
Tns4 T G 11: 99,085,703 M131L probably benign Het
Trim66 C T 7: 109,484,577 probably null Het
Ttll6 T A 11: 96,139,775 probably null Het
Ttn A T 2: 76,969,703 I387N probably damaging Het
Ubqln5 T A 7: 104,128,741 Q292L probably damaging Het
Vmn1r74 G T 7: 11,847,375 V201F probably damaging Het
Vmn2r28 G T 7: 5,488,314 D311E possibly damaging Het
Vtn T A 11: 78,499,716 V67E probably damaging Het
Xirp2 T A 2: 67,509,049 F545I probably damaging Het
Other mutations in Rai14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01107:Rai14 APN 15 10599711 splice site probably benign
IGL01625:Rai14 APN 15 10572374 missense probably benign 0.30
IGL01925:Rai14 APN 15 10595862 missense possibly damaging 0.88
IGL02053:Rai14 APN 15 10633156 missense probably benign 0.00
IGL02531:Rai14 APN 15 10574782 missense probably damaging 1.00
IGL02748:Rai14 APN 15 10589335 missense probably benign 0.14
IGL02945:Rai14 APN 15 10574709 missense probably benign 0.00
PIT4618001:Rai14 UTSW 15 10575156 missense probably damaging 1.00
R1400:Rai14 UTSW 15 10571548 missense probably damaging 0.98
R1583:Rai14 UTSW 15 10587916 missense probably damaging 1.00
R1686:Rai14 UTSW 15 10592196 missense probably damaging 0.98
R1721:Rai14 UTSW 15 10633228 missense probably damaging 1.00
R1867:Rai14 UTSW 15 10633228 missense probably damaging 1.00
R1868:Rai14 UTSW 15 10633228 missense probably damaging 1.00
R2118:Rai14 UTSW 15 10575166 missense probably benign 0.00
R3161:Rai14 UTSW 15 10633164 missense possibly damaging 0.74
R3162:Rai14 UTSW 15 10633164 missense possibly damaging 0.74
R3162:Rai14 UTSW 15 10633164 missense possibly damaging 0.74
R4049:Rai14 UTSW 15 10592212 missense probably benign 0.30
R4611:Rai14 UTSW 15 10592138 missense probably damaging 1.00
R4760:Rai14 UTSW 15 10575690 missense possibly damaging 0.60
R4863:Rai14 UTSW 15 10572470 missense probably damaging 0.99
R5022:Rai14 UTSW 15 10574506 missense probably damaging 0.96
R5110:Rai14 UTSW 15 10690410 start gained probably benign
R5410:Rai14 UTSW 15 10574938 missense probably damaging 1.00
R5643:Rai14 UTSW 15 10593051 missense probably benign 0.03
R5644:Rai14 UTSW 15 10593051 missense probably benign 0.03
R5681:Rai14 UTSW 15 10575120 missense probably damaging 1.00
R5934:Rai14 UTSW 15 10575159 missense probably damaging 0.98
R6333:Rai14 UTSW 15 10574936 nonsense probably null
R6338:Rai14 UTSW 15 10574976 missense probably damaging 1.00
R6864:Rai14 UTSW 15 10633168 missense possibly damaging 0.95
R7015:Rai14 UTSW 15 10589315 nonsense probably null
R7155:Rai14 UTSW 15 10595003 missense possibly damaging 0.53
Predicted Primers PCR Primer
(F):5'- ATTTGGGTTAATGGCAGCACAC -3'
(R):5'- GGCCTTTTGAGCACTCTTTG -3'

Sequencing Primer
(F):5'- ACATCTCTAAGAAGCACACTGTG -3'
(R):5'- TGGTGCCTTTGCCATGC -3'
Posted On2014-08-25