Incidental Mutation 'R2036:Anks1b'
ID224665
Institutional Source Beutler Lab
Gene Symbol Anks1b
Ensembl Gene ENSMUSG00000058589
Gene Nameankyrin repeat and sterile alpha motif domain containing 1B
SynonymsC030032C09Rik, AIDA-1b, LOC380650, Gm10937, E530015N03Rik
MMRRC Submission 040043-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.242) question?
Stock #R2036 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location89873509-90973300 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 90969853 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 431 (V431A)
Ref Sequence ENSEMBL: ENSMUSP00000138222 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099364] [ENSMUST00000099366] [ENSMUST00000179337] [ENSMUST00000179694] [ENSMUST00000182053] [ENSMUST00000182113] [ENSMUST00000182284] [ENSMUST00000182356] [ENSMUST00000182430] [ENSMUST00000182550] [ENSMUST00000182595] [ENSMUST00000182600] [ENSMUST00000182786] [ENSMUST00000182907] [ENSMUST00000182960] [ENSMUST00000182966] [ENSMUST00000183136] [ENSMUST00000183156]
Predicted Effect probably benign
Transcript: ENSMUST00000099364
SMART Domains Protein: ENSMUSP00000096965
Gene: ENSMUSG00000058589

DomainStartEndE-ValueType
low complexity region 43 58 N/A INTRINSIC
PTB 131 269 1.5e-40 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000099366
AA Change: V247A

PolyPhen 2 Score 0.132 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000096967
Gene: ENSMUSG00000058589
AA Change: V247A

DomainStartEndE-ValueType
PTB 63 201 2.94e-38 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000179337
AA Change: V247A

PolyPhen 2 Score 0.132 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000136410
Gene: ENSMUSG00000058589
AA Change: V247A

DomainStartEndE-ValueType
low complexity region 43 58 N/A INTRINSIC
PTB 156 294 1.6e-40 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000179694
AA Change: V247A

PolyPhen 2 Score 0.132 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000136146
Gene: ENSMUSG00000058589
AA Change: V247A

DomainStartEndE-ValueType
PTB 96 234 1.5e-40 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182053
AA Change: V375A

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000138644
Gene: ENSMUSG00000058589
AA Change: V375A

DomainStartEndE-ValueType
SAM 2 71 1.19e-19 SMART
SAM 76 144 5.66e-17 SMART
PTB 192 330 2.94e-38 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182113
AA Change: V491A

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000138655
Gene: ENSMUSG00000058589
AA Change: V491A

DomainStartEndE-ValueType
SAM 33 102 1.19e-19 SMART
SAM 107 175 5.66e-17 SMART
low complexity region 195 210 N/A INTRINSIC
PTB 307 445 2.94e-38 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182284
AA Change: V432A

PolyPhen 2 Score 0.235 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000138794
Gene: ENSMUSG00000058589
AA Change: V432A

DomainStartEndE-ValueType
SAM 33 102 1.19e-19 SMART
SAM 107 175 5.66e-17 SMART
PTB 248 386 2.94e-38 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182356
SMART Domains Protein: ENSMUSP00000138234
Gene: ENSMUSG00000058589

DomainStartEndE-ValueType
SAM 1 45 4.05e1 SMART
SAM 50 118 5.66e-17 SMART
low complexity region 138 153 N/A INTRINSIC
PTB 226 364 2.94e-38 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182430
AA Change: V407A

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000138660
Gene: ENSMUSG00000058589
AA Change: V407A

DomainStartEndE-ValueType
SAM 33 102 1.19e-19 SMART
SAM 107 175 5.66e-17 SMART
PTB 223 361 2.94e-38 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000182550
AA Change: V492A

PolyPhen 2 Score 0.918 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000138643
Gene: ENSMUSG00000058589
AA Change: V492A

DomainStartEndE-ValueType
SAM 33 102 1.19e-19 SMART
SAM 107 175 5.66e-17 SMART
low complexity region 195 210 N/A INTRINSIC
PTB 308 446 2.94e-38 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000182595
AA Change: V467A

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000138314
Gene: ENSMUSG00000058589
AA Change: V467A

DomainStartEndE-ValueType
SAM 33 102 1.19e-19 SMART
SAM 107 175 5.66e-17 SMART
low complexity region 195 210 N/A INTRINSIC
PTB 283 421 2.94e-38 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182600
SMART Domains Protein: ENSMUSP00000138650
Gene: ENSMUSG00000058589

DomainStartEndE-ValueType
SAM 1 45 4.05e1 SMART
SAM 50 118 5.66e-17 SMART
PTB 216 354 2.94e-38 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182786
AA Change: V338A

PolyPhen 2 Score 0.132 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000138720
Gene: ENSMUSG00000058589
AA Change: V338A

DomainStartEndE-ValueType
Pfam:SAM_2 1 42 8.4e-8 PFAM
Pfam:SAM_1 2 43 5.4e-7 PFAM
Pfam:SAM_1 51 97 4.4e-10 PFAM
Pfam:SAM_2 52 95 6.1e-7 PFAM
PTB 155 293 2.94e-38 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182907
SMART Domains Protein: ENSMUSP00000138614
Gene: ENSMUSG00000058589

DomainStartEndE-ValueType
low complexity region 21 45 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000182960
AA Change: V431A

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000138222
Gene: ENSMUSG00000058589
AA Change: V431A

DomainStartEndE-ValueType
SAM 33 102 1.19e-19 SMART
SAM 107 175 5.66e-17 SMART
PTB 247 385 2.94e-38 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182966
AA Change: V272A

PolyPhen 2 Score 0.395 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000138610
Gene: ENSMUSG00000058589
AA Change: V272A

DomainStartEndE-ValueType
PTB 88 226 2.94e-38 SMART
Predicted Effect unknown
Transcript: ENSMUST00000183024
AA Change: V108A
Predicted Effect probably benign
Transcript: ENSMUST00000183136
AA Change: V490A

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000138738
Gene: ENSMUSG00000058589
AA Change: V490A

DomainStartEndE-ValueType
SAM 33 102 1.19e-19 SMART
SAM 107 175 5.66e-17 SMART
low complexity region 195 210 N/A INTRINSIC
PTB 307 445 2.94e-38 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000183156
AA Change: V1240A

PolyPhen 2 Score 0.391 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000138539
Gene: ENSMUSG00000058589
AA Change: V1240A

DomainStartEndE-ValueType
low complexity region 21 46 N/A INTRINSIC
ANK 58 87 1.88e-5 SMART
ANK 91 123 3.13e-2 SMART
ANK 127 156 6.92e-4 SMART
ANK 160 189 3.08e-1 SMART
ANK 193 222 1.43e-5 SMART
ANK 225 254 4.75e-2 SMART
low complexity region 498 513 N/A INTRINSIC
low complexity region 551 577 N/A INTRINSIC
low complexity region 659 670 N/A INTRINSIC
SAM 806 875 2.06e-19 SMART
SAM 880 948 5.66e-17 SMART
low complexity region 968 983 N/A INTRINSIC
PTB 1056 1194 2.94e-38 SMART
Meta Mutation Damage Score 0.134 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multi-domain protein that is predominantly expressed in brain and testis. This protein interacts with amyloid beta protein precursor (AbetaPP) and may have a role in normal brain development, and in the pathogenesis of Alzheimer's disease. Expression of this gene has been shown to be elevated in patients with pre-B cell acute lymphocytic leukemia associated with t(1;19) translocation. Alternatively spliced transcript variants encoding different isoforms (some with different subcellular localization, PMID:15004329) have been described for this gene. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a conditional allele activated in neurons alters hippocampal synaptic transmission. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik A G 1: 105,743,254 D1029G probably damaging Het
4930415H17Rik C T 11: 99,685,532 C3Y unknown Het
Abr G T 11: 76,452,350 T547K probably benign Het
Akr1c21 T C 13: 4,576,306 Y110H probably damaging Het
Ankar T A 1: 72,666,530 K556* probably null Het
Ap5b1 T C 19: 5,568,869 S106P possibly damaging Het
Arhgap17 T C 7: 123,318,494 N156D possibly damaging Het
Arhgap35 T C 7: 16,563,133 E669G probably damaging Het
Arhgap44 T C 11: 65,041,492 M201V possibly damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Atg4c C T 4: 99,218,139 T112M possibly damaging Het
Bcl11a A T 11: 24,164,087 N477Y possibly damaging Het
Brinp3 A T 1: 146,701,841 I205F possibly damaging Het
Capza2 T C 6: 17,660,778 F159S probably damaging Het
Cd40 T C 2: 165,062,301 C61R probably benign Het
Cdc25c G C 18: 34,738,239 L275V probably damaging Het
Cdh23 A G 10: 60,466,043 I415T possibly damaging Het
Clnk A T 5: 38,752,800 probably null Het
Ctcfl C T 2: 173,101,985 R524Q possibly damaging Het
Cyb5r4 T G 9: 87,042,879 probably benign Het
Ddb1 T A 19: 10,610,822 probably benign Het
Ddx51 C A 5: 110,656,625 Q526K probably benign Het
Dennd6a A T 14: 26,608,119 Q56L probably damaging Het
Dhdds T C 4: 133,971,099 E142G probably damaging Het
Dnaic1 A G 4: 41,632,225 H553R probably damaging Het
Fryl T C 5: 73,022,544 N2908S probably benign Het
Fryl C A 5: 73,107,962 probably null Het
Fut9 A G 4: 25,620,322 I164T probably damaging Het
Gba2 G A 4: 43,568,118 probably benign Het
Gm11627 C T 11: 102,576,754 V33I unknown Het
Helz2 T A 2: 181,237,479 H782L probably benign Het
Kcnmb3 A G 3: 32,472,382 V220A probably damaging Het
Kif20a T C 18: 34,628,462 S303P possibly damaging Het
Kif22 A T 7: 127,030,954 V470E possibly damaging Het
Majin C T 19: 6,213,312 T132M probably benign Het
Mboat7 A G 7: 3,685,672 probably null Het
Mkrn2 C A 6: 115,611,914 P206Q probably benign Het
Mphosph9 G A 5: 124,304,211 T358M probably damaging Het
Nkd1 A G 8: 88,591,677 D210G probably damaging Het
Olfr1215 C T 2: 89,001,632 V219I probably damaging Het
Olfr1287 T A 2: 111,449,626 L162Q possibly damaging Het
Olfr1411 A T 1: 92,596,606 E29V probably benign Het
Olfr1443 G C 19: 12,680,801 G231A probably damaging Het
Olfr291 G T 7: 84,856,358 probably benign Het
Olfr494 T A 7: 108,367,740 N83K probably benign Het
Olfr781 G A 10: 129,333,672 D264N probably benign Het
Pi4ka A G 16: 17,303,112 Y63H probably damaging Het
Plekha1 A G 7: 130,902,192 R210G probably damaging Het
Ppp2r2c C T 5: 36,952,404 T369I possibly damaging Het
Rmnd1 T C 10: 4,407,884 D12G probably damaging Het
Rtn2 A G 7: 19,293,739 K120E probably damaging Het
Sh3tc1 A G 5: 35,716,164 S30P probably benign Het
Tln2 T C 9: 67,272,704 E795G possibly damaging Het
Tmprss11d T A 5: 86,309,269 Y177F probably damaging Het
Trrap C A 5: 144,828,562 D2529E probably benign Het
Vmn2r58 A G 7: 41,863,993 Y409H probably benign Het
Wdr72 T A 9: 74,151,594 V323D probably damaging Het
Other mutations in Anks1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01669:Anks1b APN 10 90897238 splice site probably benign
IGL01890:Anks1b APN 10 90644527 missense probably benign 0.15
IGL01966:Anks1b APN 10 90895132 missense probably damaging 1.00
IGL02176:Anks1b APN 10 90042668 missense probably damaging 0.99
IGL02205:Anks1b APN 10 90071094 missense probably benign 0.00
IGL02465:Anks1b APN 10 90163265 nonsense probably null
IGL02534:Anks1b APN 10 90895117 missense probably benign 0.45
IGL02554:Anks1b APN 10 90921378 missense probably damaging 1.00
IGL02820:Anks1b APN 10 90077059 missense possibly damaging 0.93
IGL03164:Anks1b APN 10 90042692 missense probably damaging 1.00
R0096:Anks1b UTSW 10 90074062 missense possibly damaging 0.90
R0482:Anks1b UTSW 10 90359195 missense probably benign 0.00
R0542:Anks1b UTSW 10 90073967 splice site probably benign
R0848:Anks1b UTSW 10 90071125 missense probably damaging 0.99
R1056:Anks1b UTSW 10 90921429 splice site probably null
R1398:Anks1b UTSW 10 90050029 missense probably damaging 1.00
R1446:Anks1b UTSW 10 90511073 missense probably benign 0.00
R1548:Anks1b UTSW 10 90049985 missense possibly damaging 0.79
R1551:Anks1b UTSW 10 90076981 missense probably benign 0.00
R1607:Anks1b UTSW 10 90042548 missense probably damaging 1.00
R1667:Anks1b UTSW 10 90511184 critical splice donor site probably null
R1701:Anks1b UTSW 10 90049954 missense probably damaging 1.00
R1843:Anks1b UTSW 10 90512889 critical splice donor site probably null
R1899:Anks1b UTSW 10 90260756 missense probably damaging 1.00
R1957:Anks1b UTSW 10 90049930 missense probably damaging 1.00
R2279:Anks1b UTSW 10 90050096 missense probably damaging 1.00
R2280:Anks1b UTSW 10 90966302 missense probably damaging 1.00
R2937:Anks1b UTSW 10 90077066 missense probably damaging 1.00
R3739:Anks1b UTSW 10 90033216 missense probably damaging 1.00
R4061:Anks1b UTSW 10 90307622 missense probably damaging 0.98
R4459:Anks1b UTSW 10 90510844 missense probably damaging 1.00
R4479:Anks1b UTSW 10 90049892 missense probably damaging 1.00
R4510:Anks1b UTSW 10 90510790 missense probably benign 0.01
R4511:Anks1b UTSW 10 90510790 missense probably benign 0.01
R4780:Anks1b UTSW 10 89873732 missense probably damaging 1.00
R4785:Anks1b UTSW 10 90914750 missense probably null 0.88
R4790:Anks1b UTSW 10 90163275 missense probably damaging 0.99
R5012:Anks1b UTSW 10 90359137 missense probably benign 0.06
R5400:Anks1b UTSW 10 90512824 missense probably damaging 1.00
R5586:Anks1b UTSW 10 90077064 missense probably damaging 0.98
R5687:Anks1b UTSW 10 90914711 missense probably benign 0.03
R5899:Anks1b UTSW 10 90923517 splice site probably null
R5917:Anks1b UTSW 10 90576941 intron probably benign
R5999:Anks1b UTSW 10 90359048 missense probably damaging 1.00
R6080:Anks1b UTSW 10 90966349 nonsense probably null
R6216:Anks1b UTSW 10 90260756 missense probably damaging 1.00
R6265:Anks1b UTSW 10 90941500 missense probably damaging 1.00
R6298:Anks1b UTSW 10 90680837 missense probably damaging 1.00
R6337:Anks1b UTSW 10 90921296 missense probably benign 0.27
R6522:Anks1b UTSW 10 90897327 intron probably benign
R6843:Anks1b UTSW 10 90948598 missense probably damaging 1.00
R6852:Anks1b UTSW 10 90260654 missense probably damaging 1.00
R6933:Anks1b UTSW 10 90069490 missense probably damaging 1.00
R7114:Anks1b UTSW 10 90307698 missense probably damaging 1.00
X0064:Anks1b UTSW 10 90512845 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGGACGTAGGGTTCTTTCC -3'
(R):5'- AAAGTCTCGCTGGCAGAAG -3'

Sequencing Primer
(F):5'- ACGTAGGGTTCTTTCCGGACC -3'
(R):5'- CAGAAGGCTCCCTAGGGATG -3'
Posted On2014-08-25