Incidental Mutation 'R2037:Fcmr'
ID224715
Institutional Source Beutler Lab
Gene Symbol Fcmr
Ensembl Gene ENSMUSG00000042474
Gene NameFc fragment of IgM receptor
Synonyms1810037B05Rik, FcmuR, Faim3
MMRRC Submission 040044-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2037 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location130865669-130880791 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 130878333 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 342 (D342G)
Ref Sequence ENSEMBL: ENSMUSP00000048303 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038829] [ENSMUST00000121040] [ENSMUST00000187650] [ENSMUST00000191279]
Predicted Effect possibly damaging
Transcript: ENSMUST00000038829
AA Change: D342G

PolyPhen 2 Score 0.613 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000048303
Gene: ENSMUSG00000042474
AA Change: D342G

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:V-set 21 122 1.3e-10 PFAM
low complexity region 212 223 N/A INTRINSIC
transmembrane domain 264 283 N/A INTRINSIC
low complexity region 285 311 N/A INTRINSIC
low complexity region 344 363 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121040
SMART Domains Protein: ENSMUSP00000113064
Gene: ENSMUSG00000026420

DomainStartEndE-ValueType
low complexity region 44 56 N/A INTRINSIC
IL10 76 219 1.14e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126821
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145446
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149355
Predicted Effect probably benign
Transcript: ENSMUST00000187650
SMART Domains Protein: ENSMUSP00000140149
Gene: ENSMUSG00000026420

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
IL10 37 180 5.4e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000191279
SMART Domains Protein: ENSMUSP00000140821
Gene: ENSMUSG00000026420

DomainStartEndE-ValueType
low complexity region 44 56 N/A INTRINSIC
Blast:IL10 76 118 2e-21 BLAST
SCOP:d2ilk__ 80 119 2e-9 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Fc receptors specifically bind to the Fc region of immunoglobulins (Igs) to mediate the unique functions of each Ig class. FAIM3 encodes an Fc receptor for IgM (see MIM 147020) (Kubagawa et al., 2009 [PubMed 19858324]; Shima et al., 2010 [PubMed 20042454]).[supplied by OMIM, Jul 2010]
PHENOTYPE: Mice homozygous for knock-out alleles exhibit a slight decrease in B cell numbers reduced sensitivity to Gal-induced liver damage, increased granulocyte production of ROS and increased sensitivity to infection by Listeria monocytogenes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a A T 11: 110,089,984 probably null Het
AI987944 T C 7: 41,374,391 Y391C probably benign Het
Ankfn1 A T 11: 89,456,120 S296T probably benign Het
Apob A G 12: 8,007,488 D1957G probably benign Het
Baz1a G T 12: 54,929,646 P415Q probably damaging Het
Brca2 T A 5: 150,540,669 H1299Q probably benign Het
C7 G T 15: 5,034,238 S227* probably null Het
Catsperb A T 12: 101,507,962 R306S probably damaging Het
Cbx3 T A 6: 51,471,813 probably null Het
Ccdc129 A G 6: 55,897,875 N270S probably benign Het
Ccnt2 A G 1: 127,803,399 Y671C probably damaging Het
Crocc A G 4: 141,046,942 probably null Het
Ctr9 G A 7: 111,046,807 V669I probably benign Het
Dck T G 5: 88,772,717 Y99D probably damaging Het
Ddx52 T A 11: 83,944,606 D119E probably benign Het
Dnah10 A T 5: 124,746,704 K596N probably benign Het
Dnah7a A T 1: 53,582,582 V1128E probably benign Het
Dph1 A T 11: 75,185,853 probably null Het
Enah G A 1: 181,921,972 P415L probably damaging Het
Enthd1 A G 15: 80,560,349 S2P possibly damaging Het
Erc1 A C 6: 119,722,255 V802G possibly damaging Het
F8 ATCTCTCTC ATCTCTC X: 75,322,998 probably null Het
Fam169a C A 13: 97,107,092 A210E probably benign Het
Fgfr4 T G 13: 55,167,889 V743G possibly damaging Het
Fsip2 A G 2: 82,978,512 D1725G probably damaging Het
Heatr5b A T 17: 78,829,505 C195* probably null Het
Herc2 G A 7: 56,205,961 A3882T probably damaging Het
Il20 T A 1: 130,908,378 N143Y probably damaging Het
Inpp5b A G 4: 124,798,299 S892G probably damaging Het
Ipo13 A T 4: 117,904,661 Y447* probably null Het
Kbtbd12 A T 6: 88,617,797 N350K probably benign Het
Kiz T C 2: 146,969,960 F663S probably damaging Het
Matn2 A G 15: 34,433,117 D870G probably benign Het
Methig1 C T 15: 100,353,586 A126V probably benign Het
Mme A G 3: 63,328,260 D209G probably null Het
Mroh4 A G 15: 74,609,761 F811L possibly damaging Het
Myo9b G T 8: 71,290,866 K190N probably damaging Het
Ncf1 T C 5: 134,229,552 I6V probably damaging Het
Nmt2 T C 2: 3,309,581 F121L probably damaging Het
Nol10 A G 12: 17,361,151 D183G probably benign Het
Nsun7 T C 5: 66,261,086 V53A probably benign Het
Olfr1045 T C 2: 86,197,832 S307G probably benign Het
Olfr1054 T C 2: 86,332,430 N309D probably benign Het
Olfr819 T C 10: 129,966,140 I187V probably benign Het
Pappa2 A T 1: 158,956,644 Y265* probably null Het
Pigg G A 5: 108,338,652 A724T probably damaging Het
Pik3r4 C T 9: 105,650,335 R296C probably benign Het
Pkhd1l1 A G 15: 44,568,221 probably null Het
Pld4 A G 12: 112,768,558 D483G probably damaging Het
Ppip5k1 C T 2: 121,343,193 R399H probably damaging Het
Qrfpr A T 3: 36,182,657 H198Q probably damaging Het
Rasgrf2 A T 13: 91,902,629 D883E probably damaging Het
Retnlg T C 16: 48,874,252 C88R probably damaging Het
Sin3a C T 9: 57,096,825 T287I probably benign Het
Slc44a1 GCC GCCCCC 4: 53,563,243 probably benign Het
Sppl2c G C 11: 104,186,481 V36L probably benign Het
Srp72 T A 5: 76,976,491 I68N probably damaging Het
Srrm3 T A 5: 135,854,377 S195R probably damaging Het
Srrm4 T A 5: 116,467,828 probably benign Het
Ssb A G 2: 69,868,819 S199G probably benign Het
Sult2a6 T A 7: 14,254,709 Y42F probably damaging Het
Syne2 A G 12: 76,025,569 T120A probably benign Het
Tas1r1 A G 4: 152,028,170 F809L probably damaging Het
Tead3 A G 17: 28,336,570 S117P probably damaging Het
Tefm C T 11: 80,140,230 R60H probably damaging Het
Tmem104 G A 11: 115,201,395 R110H possibly damaging Het
Tnxb G A 17: 34,699,205 G2364D probably damaging Het
Vmn1r211 T A 13: 22,851,964 I178F probably damaging Het
Vmn1r6 A T 6: 57,003,124 Y235F probably damaging Het
Xrcc5 C A 1: 72,346,370 T540K probably benign Het
Other mutations in Fcmr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01638:Fcmr APN 1 130875122 missense probably benign 0.06
IGL01652:Fcmr APN 1 130878507 missense probably benign 0.25
IGL02106:Fcmr APN 1 130875135 missense probably benign
IGL03270:Fcmr APN 1 130876042 missense possibly damaging 0.63
R1635:Fcmr UTSW 1 130876185 splice site probably null
R1651:Fcmr UTSW 1 130878251 missense probably benign
R1728:Fcmr UTSW 1 130875974 missense probably benign
R1728:Fcmr UTSW 1 130878269 missense probably benign 0.00
R1729:Fcmr UTSW 1 130875974 missense probably benign
R1729:Fcmr UTSW 1 130878269 missense probably benign 0.00
R1730:Fcmr UTSW 1 130875974 missense probably benign
R1730:Fcmr UTSW 1 130878269 missense probably benign 0.00
R1739:Fcmr UTSW 1 130875974 missense probably benign
R1739:Fcmr UTSW 1 130878269 missense probably benign 0.00
R1762:Fcmr UTSW 1 130875974 missense probably benign
R1762:Fcmr UTSW 1 130878269 missense probably benign 0.00
R1783:Fcmr UTSW 1 130875974 missense probably benign
R1783:Fcmr UTSW 1 130878269 missense probably benign 0.00
R1784:Fcmr UTSW 1 130875974 missense probably benign
R1784:Fcmr UTSW 1 130878269 missense probably benign 0.00
R1785:Fcmr UTSW 1 130875974 missense probably benign
R1785:Fcmr UTSW 1 130878269 missense probably benign 0.00
R6111:Fcmr UTSW 1 130877829 missense probably damaging 0.96
R6217:Fcmr UTSW 1 130878323 missense probably damaging 0.96
R6538:Fcmr UTSW 1 130875025 missense possibly damaging 0.72
R6712:Fcmr UTSW 1 130877851 missense probably damaging 0.99
R6965:Fcmr UTSW 1 130875987 missense possibly damaging 0.65
X0025:Fcmr UTSW 1 130874267 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTCTTGGTGACCTCCTGAAGC -3'
(R):5'- AGGGCTTCAATTTAGGGACTGG -3'

Sequencing Primer
(F):5'- TGAAGCCTCCTCCAGACGTG -3'
(R):5'- AGCTTACCTGCGGAGAAGC -3'
Posted On2014-08-25