Incidental Mutation 'R0144:Col11a1'
ID22489
Institutional Source Beutler Lab
Gene Symbol Col11a1
Ensembl Gene ENSMUSG00000027966
Gene Namecollagen, type XI, alpha 1
SynonymsC530001D20Rik
MMRRC Submission 038429-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.839) question?
Stock #R0144 (G1)
Quality Score225
Status Validated (trace)
Chromosome3
Chromosomal Location114030540-114220718 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 114113594 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 628 (D628V)
Ref Sequence ENSEMBL: ENSMUSP00000089793 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092155]
Predicted Effect unknown
Transcript: ENSMUST00000092155
AA Change: D628V
SMART Domains Protein: ENSMUSP00000089793
Gene: ENSMUSG00000027966
AA Change: D628V

DomainStartEndE-ValueType
TSPN 37 228 1.83e-62 SMART
LamG 96 227 5.87e-11 SMART
low complexity region 256 276 N/A INTRINSIC
internal_repeat_4 357 431 3.12e-6 PROSPERO
Pfam:Collagen 433 491 2.6e-9 PFAM
Pfam:Collagen 525 586 5.9e-9 PFAM
low complexity region 611 632 N/A INTRINSIC
low complexity region 638 677 N/A INTRINSIC
Pfam:Collagen 721 805 3.6e-8 PFAM
internal_repeat_3 814 854 3.55e-9 PROSPERO
internal_repeat_1 818 869 2.01e-16 PROSPERO
low complexity region 872 944 N/A INTRINSIC
low complexity region 952 1001 N/A INTRINSIC
low complexity region 1031 1059 N/A INTRINSIC
low complexity region 1066 1100 N/A INTRINSIC
low complexity region 1103 1121 N/A INTRINSIC
internal_repeat_2 1124 1188 2.4e-12 PROSPERO
low complexity region 1189 1205 N/A INTRINSIC
low complexity region 1211 1232 N/A INTRINSIC
low complexity region 1235 1250 N/A INTRINSIC
low complexity region 1252 1368 N/A INTRINSIC
low complexity region 1373 1392 N/A INTRINSIC
low complexity region 1417 1448 N/A INTRINSIC
low complexity region 1453 1463 N/A INTRINSIC
Pfam:Collagen 1481 1543 8.3e-9 PFAM
COLFI 1574 1803 7.28e-127 SMART
Meta Mutation Damage Score 0.18 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.0%
  • 20x: 87.0%
Validation Efficiency 100% (90/90)
MGI Phenotype FUNCTION: This gene encodes the alpha-1 subunit of type XI collagen, one of the low abundance fibrillar collagens that is essential for normal embryonic skeletal development and the cohesive properties of cartilage. The encoded protein, in association with the alpha-1 subunit of type II collagen, forms a heterotrimeric type XI procollagen that undergoes proteolytic processing. Mice lacking the encoded protein develop severe chondrodysplasia and die at birth. [provided by RefSeq, Dec 2015]
PHENOTYPE: Homozygous mutation of this gene results in perinatal lethality by asphyxia. Mutants animals display weak tracheal cartilage, short snout, short mandible, cleft palate, short limbs, and externally rotated distal portion of the hindlimbs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcd4 T A 12: 84,605,965 probably null Het
Acp6 T A 3: 97,165,829 probably benign Het
AI661453 A T 17: 47,469,299 probably benign Het
Aox1 A G 1: 58,070,074 I674V probably benign Het
Armc2 A T 10: 41,947,887 probably benign Het
Atp8b1 G C 18: 64,571,374 probably benign Het
Baz2b A T 2: 59,907,495 N1823K probably damaging Het
Bbx C T 16: 50,280,392 E47K probably benign Het
Brca1 A T 11: 101,526,121 S396T probably damaging Het
Btnl6 G T 17: 34,514,020 R290S probably benign Het
Casp8ap2 A G 4: 32,643,797 R957G possibly damaging Het
Ccdc13 A G 9: 121,827,351 L132P probably damaging Het
Ccdc187 A G 2: 26,276,203 I738T probably damaging Het
Ccdc58 A T 16: 36,085,114 N92I possibly damaging Het
Ceacam15 G T 7: 16,673,191 H134N probably benign Het
Cep170 T C 1: 176,792,595 I46V probably benign Het
Cfap57 T C 4: 118,584,705 D722G probably damaging Het
Csmd1 A T 8: 16,391,824 V342E probably benign Het
Dennd1a A G 2: 38,126,640 V64A probably damaging Het
Dlec1 G T 9: 119,142,866 G1345V probably benign Het
Dnah1 G A 14: 31,267,874 probably benign Het
Dock5 C T 14: 67,786,286 G1142D probably benign Het
Etv2 C A 7: 30,634,883 A142S probably benign Het
Fam110c C A 12: 31,074,501 T154K unknown Het
Fbxo17 C G 7: 28,735,340 D183E probably damaging Het
Fbxo30 T A 10: 11,295,220 W681R probably damaging Het
Fig4 A G 10: 41,258,049 Y413H probably damaging Het
Gab1 A G 8: 80,785,201 probably benign Het
Gabarapl1 T C 6: 129,533,448 M1T probably null Het
Gm4763 A G 7: 24,723,590 V101A possibly damaging Het
H2-M10.6 G A 17: 36,812,241 C22Y probably damaging Het
Igfn1 T C 1: 135,962,013 D2432G probably damaging Het
Il13 T C 11: 53,633,176 D60G possibly damaging Het
Iqgap1 A G 7: 80,751,920 L479P probably damaging Het
Itpr2 T A 6: 146,327,155 Q1314L probably damaging Het
Jrk C T 15: 74,706,156 G427S probably benign Het
Kcnb1 T G 2: 167,104,547 N794H probably damaging Het
Klhl8 A T 5: 103,867,938 S361R probably benign Het
Krt87 T C 15: 101,438,661 Y37C probably benign Het
Lbp A T 2: 158,319,710 S231C probably damaging Het
Lpin2 A G 17: 71,225,076 E142G probably damaging Het
Lrch4 G A 5: 137,638,543 probably null Het
Manea A G 4: 26,340,719 M81T probably benign Het
Mcm3ap A G 10: 76,481,015 T618A probably benign Het
Me3 A G 7: 89,739,872 D128G probably damaging Het
Mug2 A G 6: 122,071,011 probably benign Het
Myo9b A T 8: 71,346,043 Q901L probably damaging Het
Nalcn C T 14: 123,409,839 probably benign Het
Nalcn T C 14: 123,371,536 R640G probably damaging Het
Ncor1 T C 11: 62,392,595 N422S probably damaging Het
Nf1 T A 11: 79,547,127 Y88N probably damaging Het
Nrxn3 G A 12: 89,348,392 A358T probably damaging Het
Olfr1458 G A 19: 13,103,278 R3C possibly damaging Het
Olfr486 T C 7: 108,171,971 I258V probably benign Het
Olfr593 A T 7: 103,212,540 I216F probably damaging Het
Phlpp2 C T 8: 109,907,513 R242W probably damaging Het
Pld5 T C 1: 175,970,541 N431D probably benign Het
Prss28 G A 17: 25,309,450 V16M probably damaging Het
Psmd2 T A 16: 20,662,225 probably null Het
Ptpn21 A T 12: 98,688,609 S700T probably benign Het
Rasa2 A T 9: 96,592,019 V152D probably damaging Het
Reln G T 5: 21,948,449 R2286S probably damaging Het
Rflnb G T 11: 76,024,963 P102Q probably damaging Het
Rin2 G A 2: 145,876,639 V680I probably damaging Het
Rnf213 A T 11: 119,479,600 K4742* probably null Het
Rpp40 A T 13: 35,901,369 S143T probably benign Het
Rps12 A G 10: 23,786,791 I51T probably benign Het
Rsf1 T A 7: 97,636,407 W109R probably damaging Het
Sipa1l2 C T 8: 125,449,876 probably null Het
Tspan5 G T 3: 138,898,348 V165L probably damaging Het
Uts2r T A 11: 121,161,465 V385E probably benign Het
Vma21-ps T A 4: 52,497,231 D5V possibly damaging Het
Vmn2r62 T A 7: 42,789,016 N132I probably damaging Het
Zfp622 T C 15: 25,991,579 probably benign Het
Zmiz1 A G 14: 25,655,247 K766R probably damaging Het
Other mutations in Col11a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00474:Col11a1 APN 3 114066533 missense unknown
IGL00578:Col11a1 APN 3 114194106 missense possibly damaging 0.95
IGL00742:Col11a1 APN 3 114124315 missense unknown
IGL01014:Col11a1 APN 3 114123809 splice site probably benign
IGL01099:Col11a1 APN 3 114112041 nonsense probably null
IGL01129:Col11a1 APN 3 114185873 splice site probably benign
IGL01474:Col11a1 APN 3 114217134 utr 3 prime probably benign
IGL01884:Col11a1 APN 3 114066542 missense unknown
IGL02104:Col11a1 APN 3 114181397 critical splice donor site probably null
IGL02715:Col11a1 APN 3 114129409 missense probably benign 0.06
IGL02978:Col11a1 APN 3 114061562 missense unknown
IGL03203:Col11a1 APN 3 114212084 missense possibly damaging 0.91
IGL03240:Col11a1 APN 3 114217210 splice site probably null
IGL03357:Col11a1 APN 3 114194091 missense probably damaging 1.00
IGL03390:Col11a1 APN 3 114090253 missense unknown
gluon UTSW 3 114217170 utr 3 prime probably benign
uncovered UTSW 3 114112467 unclassified probably benign
R0110:Col11a1 UTSW 3 114105456 splice site probably benign
R0432:Col11a1 UTSW 3 114205901 splice site probably benign
R0468:Col11a1 UTSW 3 114217058 utr 3 prime probably benign
R0510:Col11a1 UTSW 3 114105456 splice site probably benign
R0535:Col11a1 UTSW 3 114061535 missense unknown
R0608:Col11a1 UTSW 3 114218715 utr 3 prime probably benign
R0826:Col11a1 UTSW 3 114138765 missense unknown
R0827:Col11a1 UTSW 3 114138765 missense unknown
R0862:Col11a1 UTSW 3 114138765 missense unknown
R0863:Col11a1 UTSW 3 114138765 missense unknown
R0926:Col11a1 UTSW 3 114090180 missense unknown
R0980:Col11a1 UTSW 3 114138765 missense unknown
R0981:Col11a1 UTSW 3 114138765 missense unknown
R1004:Col11a1 UTSW 3 114095022 splice site probably benign
R1037:Col11a1 UTSW 3 114194152 missense probably damaging 1.00
R1171:Col11a1 UTSW 3 114066564 missense unknown
R1316:Col11a1 UTSW 3 114138970 splice site probably null
R1324:Col11a1 UTSW 3 114030916 missense unknown
R1338:Col11a1 UTSW 3 114216995 utr 3 prime probably benign
R1513:Col11a1 UTSW 3 114097154 missense unknown
R1528:Col11a1 UTSW 3 114216995 utr 3 prime probably benign
R1567:Col11a1 UTSW 3 114138612 missense unknown
R1596:Col11a1 UTSW 3 114152613 utr 3 prime probably benign
R1605:Col11a1 UTSW 3 114131641 missense probably damaging 1.00
R1624:Col11a1 UTSW 3 114158155 missense probably damaging 0.97
R1626:Col11a1 UTSW 3 114131569 missense probably damaging 1.00
R1666:Col11a1 UTSW 3 114061535 missense unknown
R1806:Col11a1 UTSW 3 114158142 missense probably damaging 1.00
R2001:Col11a1 UTSW 3 114165293 splice site probably null
R2084:Col11a1 UTSW 3 114158142 missense probably damaging 1.00
R2085:Col11a1 UTSW 3 114158142 missense probably damaging 1.00
R3926:Col11a1 UTSW 3 114090124 splice site probably benign
R3950:Col11a1 UTSW 3 114121445 critical splice donor site probably null
R3970:Col11a1 UTSW 3 114097189 missense unknown
R4171:Col11a1 UTSW 3 114208214 missense probably damaging 0.99
R4175:Col11a1 UTSW 3 114208223 missense possibly damaging 0.83
R4176:Col11a1 UTSW 3 114208223 missense possibly damaging 0.83
R4413:Col11a1 UTSW 3 114108316 missense unknown
R4540:Col11a1 UTSW 3 114097166 missense unknown
R5210:Col11a1 UTSW 3 114153157 missense probably damaging 1.00
R5250:Col11a1 UTSW 3 114217170 utr 3 prime probably benign
R5335:Col11a1 UTSW 3 114095240 missense unknown
R5344:Col11a1 UTSW 3 114208362 critical splice donor site probably null
R5394:Col11a1 UTSW 3 114194184 splice site probably null
R5687:Col11a1 UTSW 3 114217103 utr 3 prime probably benign
R5708:Col11a1 UTSW 3 114097094 missense unknown
R5763:Col11a1 UTSW 3 114094596 intron probably benign
R5792:Col11a1 UTSW 3 114131593 missense probably damaging 1.00
R6259:Col11a1 UTSW 3 114138447 missense probably benign
R6679:Col11a1 UTSW 3 114152719 splice site probably null
R6738:Col11a1 UTSW 3 114112467 unclassified probably benign
R6747:Col11a1 UTSW 3 114212450 nonsense probably null
R6808:Col11a1 UTSW 3 114094944 missense possibly damaging 0.87
R6861:Col11a1 UTSW 3 114167492 missense probably damaging 1.00
R7201:Col11a1 UTSW 3 114090157 missense unknown
R7264:Col11a1 UTSW 3 114185599 missense unknown
R7393:Col11a1 UTSW 3 114097106 missense unknown
R7445:Col11a1 UTSW 3 114193929 missense unknown
R7479:Col11a1 UTSW 3 114102569 missense unknown
X0018:Col11a1 UTSW 3 114112233 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- AGTTGTGCCCATTCTTAACAGGCTC -3'
(R):5'- TCCTTACAGCTTCACCTGGAAGACC -3'

Sequencing Primer
(F):5'- TCTAGCATACTAATTTGTAAAGCCTG -3'
(R):5'- TCACCTGGAAGACCCCTGG -3'
Posted On2013-04-16