Incidental Mutation 'R2041:Ube3b'
ID224907
Institutional Source Beutler Lab
Gene Symbol Ube3b
Ensembl Gene ENSMUSG00000029577
Gene Nameubiquitin protein ligase E3B
Synonyms
MMRRC Submission 040048-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2041 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location114380607-114421169 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 114387233 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 39 (L39P)
Ref Sequence ENSEMBL: ENSMUSP00000138723 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074002] [ENSMUST00000130169] [ENSMUST00000151809]
Predicted Effect possibly damaging
Transcript: ENSMUST00000074002
AA Change: L39P

PolyPhen 2 Score 0.661 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000073652
Gene: ENSMUSG00000029577
AA Change: L39P

DomainStartEndE-ValueType
IQ 28 50 1.17e-2 SMART
low complexity region 310 327 N/A INTRINSIC
low complexity region 412 428 N/A INTRINSIC
low complexity region 470 488 N/A INTRINSIC
HECTc 697 1070 2.15e-110 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000130169
AA Change: L39P

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000138723
Gene: ENSMUSG00000029577
AA Change: L39P

DomainStartEndE-ValueType
IQ 28 50 1.17e-2 SMART
Predicted Effect unknown
Transcript: ENSMUST00000151809
AA Change: L39P
SMART Domains Protein: ENSMUSP00000142943
Gene: ENSMUSG00000029577
AA Change: L39P

DomainStartEndE-ValueType
IQ 28 50 5.6e-5 SMART
Meta Mutation Damage Score 0.0304 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: E1 ubiquitin-activating enzymes, E2 ubiquitin-conjugating enzymes, and E3 ubiquitin-protein ligases. This gene encodes a member of the E3 ubiquitin-conjugating enzyme family which accepts ubiquitin from an E2 ubiquitin-conjugating enzyme and transfers the ubiquitin to the targeted substrates. A HECT (homology to E6-AP C-terminus) domain in the C-terminus of the longer isoform of this protein is the catalytic site of ubiquitin transfer and forms a complex with E2 conjugases. Shorter isoforms of this protein which lack the C-terminal HECT domain are therefore unlikely to bind E2 enzymes. Alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit preweaning lethality, reduced fertility, decreased growth, reduced grip strength, impaired hearing, eye inflammation and decreased cholesterol level. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018F24Rik T A 5: 145,045,401 D265E probably damaging Het
2610021A01Rik A G 7: 41,625,979 R369G possibly damaging Het
Actr3b T C 5: 25,760,130 probably null Het
Adamts12 A T 15: 11,215,735 M281L probably damaging Het
Aipl1 T A 11: 72,031,506 M126L possibly damaging Het
Akap12 C T 10: 4,356,489 P1100S probably benign Het
Alox8 T A 11: 69,197,691 H40L possibly damaging Het
Anks1 T A 17: 28,008,414 F659L probably damaging Het
Asxl3 G T 18: 22,523,451 R1506L probably benign Het
Bicd2 A G 13: 49,341,776 T36A probably benign Het
Ccar1 A T 10: 62,766,048 L448Q probably damaging Het
Ccdc17 T G 4: 116,599,592 N497K probably damaging Het
Chek2 T C 5: 110,848,664 I164T probably damaging Het
Cntnap5c T C 17: 58,104,770 probably null Het
Cntnap5c T A 17: 58,198,989 D669E probably benign Het
Cpsf6 A G 10: 117,359,128 I482T probably damaging Het
Csf3 C T 11: 98,701,657 S65L possibly damaging Het
Dlc1 A G 8: 36,582,768 Y1049H probably damaging Het
Dnah6 T C 6: 73,073,439 D3048G probably damaging Het
Eif4g3 T A 4: 138,105,306 probably benign Het
Epb41l4b T C 4: 57,084,070 K195R probably damaging Het
Epn1 T C 7: 5,083,875 S41P probably damaging Het
Fam120a C A 13: 48,897,767 V721L probably benign Het
Fchsd1 T A 18: 37,967,676 probably null Het
Fer1l6 G A 15: 58,558,306 G194D probably damaging Het
Fpr-rs4 CAGGAA CA 17: 18,022,334 probably null Het
Fyb A C 15: 6,644,787 T635P possibly damaging Het
Gpr153 A G 4: 152,283,353 S554G probably benign Het
Grm1 A G 10: 10,746,603 F459L probably damaging Het
H60c C T 10: 3,259,972 G105D probably damaging Het
Ifnlr1 T A 4: 135,705,837 M528K possibly damaging Het
Lama4 A T 10: 39,069,991 D790V probably damaging Het
Mfsd13b T C 7: 120,991,916 probably benign Het
Mis12 T A 11: 71,025,306 I55N probably damaging Het
Morn1 T C 4: 155,090,942 Y103H probably damaging Het
Mrgpra2b C T 7: 47,464,160 V249I probably benign Het
Ndst3 C A 3: 123,672,215 G36V probably benign Het
Nlrp4a T A 7: 26,450,186 M406K probably damaging Het
Olfr1154 T C 2: 87,902,797 N293S probably damaging Het
Olfr1179 T C 2: 88,402,224 T237A probably damaging Het
Olfr1459 A T 19: 13,146,677 probably benign Het
Olfr574 T A 7: 102,948,963 V156E probably damaging Het
Olfr851 A T 9: 19,496,835 D29V probably benign Het
Pars2 A G 4: 106,653,617 T199A probably damaging Het
Plcb4 C T 2: 135,938,271 T172I probably damaging Het
Pomgnt2 A T 9: 121,982,288 W476R probably benign Het
Psg23 T A 7: 18,614,778 S35C possibly damaging Het
Pycrl T A 15: 75,919,295 probably null Het
Rab3gap1 T C 1: 127,937,990 V764A possibly damaging Het
Rgs2 A G 1: 144,002,222 F80S probably damaging Het
Sall1 A G 8: 89,032,801 L225P probably benign Het
Setd3 A G 12: 108,113,392 I284T possibly damaging Het
Slc4a9 C T 18: 36,530,793 T290I possibly damaging Het
Tmem87b T C 2: 128,831,589 V251A probably damaging Het
Ubr2 C A 17: 46,986,047 R269L probably damaging Het
Vrk2 A T 11: 26,547,914 I90K probably benign Het
Zer1 G A 2: 30,108,274 L342F probably damaging Het
Zfp984 A T 4: 147,755,339 C352S probably damaging Het
Other mutations in Ube3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00754:Ube3b APN 5 114415287 missense possibly damaging 0.93
IGL01154:Ube3b APN 5 114406252 missense probably null 0.86
IGL02632:Ube3b APN 5 114398841 missense probably benign
IGL02850:Ube3b APN 5 114406249 missense probably damaging 1.00
IGL02878:Ube3b APN 5 114404717 splice site probably null
IGL02881:Ube3b APN 5 114412884 missense possibly damaging 0.78
R0003:Ube3b UTSW 5 114398851 missense probably benign 0.17
R0071:Ube3b UTSW 5 114419497 missense probably damaging 1.00
R0071:Ube3b UTSW 5 114419497 missense probably damaging 1.00
R0076:Ube3b UTSW 5 114408217 critical splice donor site probably null
R0076:Ube3b UTSW 5 114408217 critical splice donor site probably null
R0111:Ube3b UTSW 5 114390376 splice site probably benign
R0309:Ube3b UTSW 5 114419469 splice site probably benign
R0718:Ube3b UTSW 5 114402555 nonsense probably null
R1344:Ube3b UTSW 5 114418575 missense probably damaging 1.00
R1350:Ube3b UTSW 5 114406137 intron probably null
R1418:Ube3b UTSW 5 114418575 missense probably damaging 1.00
R1732:Ube3b UTSW 5 114387445 missense probably benign 0.01
R1764:Ube3b UTSW 5 114404617 missense possibly damaging 0.89
R1975:Ube3b UTSW 5 114399865 missense possibly damaging 0.80
R2014:Ube3b UTSW 5 114411149 missense probably damaging 1.00
R2015:Ube3b UTSW 5 114411149 missense probably damaging 1.00
R2074:Ube3b UTSW 5 114415255 missense probably benign 0.14
R2202:Ube3b UTSW 5 114389074 missense probably damaging 1.00
R2205:Ube3b UTSW 5 114389074 missense probably damaging 1.00
R3826:Ube3b UTSW 5 114399951 missense probably damaging 0.99
R3829:Ube3b UTSW 5 114399951 missense probably damaging 0.99
R3830:Ube3b UTSW 5 114399951 missense probably damaging 0.99
R3927:Ube3b UTSW 5 114415680 missense probably benign 0.03
R3974:Ube3b UTSW 5 114412430 missense probably benign 0.05
R4049:Ube3b UTSW 5 114412870 missense probably benign 0.09
R4096:Ube3b UTSW 5 114393086 missense possibly damaging 0.65
R4261:Ube3b UTSW 5 114398428 missense possibly damaging 0.80
R4415:Ube3b UTSW 5 114412444 missense probably damaging 1.00
R4688:Ube3b UTSW 5 114393078 missense probably benign 0.03
R4779:Ube3b UTSW 5 114404717 splice site probably null
R4824:Ube3b UTSW 5 114415726 intron probably null
R4868:Ube3b UTSW 5 114398427 missense probably benign 0.00
R4953:Ube3b UTSW 5 114401410 missense probably benign 0.01
R5013:Ube3b UTSW 5 114407641 missense probably damaging 1.00
R5057:Ube3b UTSW 5 114406257 missense probably benign 0.01
R5117:Ube3b UTSW 5 114419631 missense probably damaging 0.96
R5131:Ube3b UTSW 5 114407546 missense probably damaging 1.00
R5498:Ube3b UTSW 5 114418574 missense probably damaging 1.00
R5564:Ube3b UTSW 5 114389075 missense probably damaging 1.00
R5572:Ube3b UTSW 5 114406179 missense probably damaging 0.99
R5580:Ube3b UTSW 5 114415323 missense probably benign
R5596:Ube3b UTSW 5 114406160 splice site probably null
R5843:Ube3b UTSW 5 114412299 missense probably damaging 1.00
R5910:Ube3b UTSW 5 114415309 missense possibly damaging 0.63
R6591:Ube3b UTSW 5 114408124 missense probably benign 0.00
R6691:Ube3b UTSW 5 114408124 missense probably benign 0.00
R7148:Ube3b UTSW 5 114406252 missense probably damaging 0.97
R7334:Ube3b UTSW 5 114415681 missense possibly damaging 0.64
R7438:Ube3b UTSW 5 114415284 missense possibly damaging 0.79
R7438:Ube3b UTSW 5 114418626 missense probably damaging 1.00
X0017:Ube3b UTSW 5 114415585 missense possibly damaging 0.77
Predicted Primers PCR Primer
(F):5'- TGTTCCACACTGTGACCCAC -3'
(R):5'- CAAAGTGCACTTCTTTTACTGGACC -3'

Sequencing Primer
(F):5'- GTGCTCCACACTGTGACC -3'
(R):5'- TTTACTGGACCCAGACTCATCAG -3'
Posted On2014-08-25