Incidental Mutation 'R1990:Glp1r'
ID225004
Institutional Source Beutler Lab
Gene Symbol Glp1r
Ensembl Gene ENSMUSG00000024027
Gene Nameglucagon-like peptide 1 receptor
SynonymsGLP-1R, GLP1Rc
Accession Numbers

Genbank: NM_021332; MGI: 99571

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1990 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location30901867-30936510 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 30930748 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 329 (C329S)
Ref Sequence ENSEMBL: ENSMUSP00000110221 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114574]
Predicted Effect possibly damaging
Transcript: ENSMUST00000114574
AA Change: C329S

PolyPhen 2 Score 0.526 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000110221
Gene: ENSMUSG00000024027
AA Change: C329S

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
HormR 58 135 9.88e-27 SMART
Pfam:7tm_2 141 398 7.4e-82 PFAM
low complexity region 440 456 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a 7-transmembrane protein that functions as a receptor for glucagon-like peptide 1 (GLP-1) hormone, which stimulates glucose-induced insulin secretion. This receptor, which functions at the cell surface, becomes internalized in response to GLP-1 and GLP-1 analogs, and it plays an important role in the signaling cascades leading to insulin secretion. It also displays neuroprotective effects in animal models. Polymorphisms in this gene are associated with diabetes. The protein is an important drug target for the treatment of type 2 diabetes and stroke. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Apr 2016]
PHENOTYPE: Glucose tolerance and pancreatic secretion is impaired in homozygous null mice. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik C T 3: 138,065,658 R203* probably null Het
9530053A07Rik A T 7: 28,154,360 D1583V probably damaging Het
Acp6 T C 3: 97,175,738 L355P probably damaging Het
Aebp2 T C 6: 140,633,738 S234P probably damaging Het
Anapc7 A G 5: 122,439,504 D374G probably benign Het
Apob A T 12: 8,001,039 I1088F probably damaging Het
Arid4b T C 13: 14,132,436 V92A probably damaging Het
Armc3 T C 2: 19,293,142 Y575H probably damaging Het
Asxl2 G T 12: 3,484,558 G252* probably null Het
Atl1 A T 12: 69,963,328 K556M probably damaging Het
AU018091 A G 7: 3,162,264 V206A probably benign Het
Bcas1 A T 2: 170,370,477 D383E possibly damaging Het
Bmx A G X: 164,232,196 W257R probably benign Het
Bpifb6 T C 2: 153,905,350 probably null Het
Cacna1b G A 2: 24,732,306 P222L probably damaging Het
Cand1 A G 10: 119,210,067 S978P probably damaging Het
Cap2 T A 13: 46,637,881 Y175N possibly damaging Het
Caps2 G A 10: 112,200,686 A384T probably benign Het
Catsperg2 A T 7: 29,721,045 Y223* probably null Het
Cd81 G T 7: 143,067,201 G206* probably null Het
Cd84 A G 1: 171,872,750 T145A possibly damaging Het
Cdkn2aip G T 8: 47,712,176 N167K probably benign Het
Ceacam14 T A 7: 17,815,365 L227* probably null Het
Ceacam5 A T 7: 17,757,880 D725V probably damaging Het
Cldn34a A T X: 152,563,845 H171L probably benign Het
Col18a1 T C 10: 77,081,154 I114V unknown Het
Cp A G 3: 19,979,013 D667G probably damaging Het
Cr2 G A 1: 195,154,150 P1278S possibly damaging Het
Crat A G 2: 30,405,048 Y452H possibly damaging Het
Cyp4f13 T A 17: 32,925,568 H318L probably damaging Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dmbt1 A G 7: 131,058,288 N527S probably damaging Het
Fgb G T 3: 83,044,253 Y256* probably null Het
Frmd3 T A 4: 74,187,439 S441T probably damaging Het
Gm13088 T A 4: 143,654,268 Y395F probably damaging Het
Gm13757 A G 2: 88,446,689 L83P probably damaging Het
Gm14190 G T 11: 99,690,605 Q46K unknown Het
Golt1b T A 6: 142,392,354 F17Y probably damaging Het
Gsdmc A G 15: 63,801,899 I179T probably benign Het
Gsdmc2 T A 15: 63,828,237 M229L probably benign Het
Gulp1 A C 1: 44,766,114 N121T possibly damaging Het
Ift122 T A 6: 115,924,367 F1037I probably damaging Het
Ildr1 A T 16: 36,716,206 Y199F probably damaging Het
Ints2 T A 11: 86,248,934 H278L possibly damaging Het
Invs T C 4: 48,392,599 V271A possibly damaging Het
Kcnj2 T C 11: 111,072,883 I367T probably benign Het
Kif21b T C 1: 136,161,770 S1115P probably damaging Het
Lce1k A T 3: 92,806,818 C20S unknown Het
Lcmt2 C A 2: 121,140,281 R107L probably benign Het
Letm1 A AG 5: 33,769,515 probably null Het
Lrrc9 A C 12: 72,497,861 R71S probably damaging Het
Mcc C A 18: 44,491,315 E213* probably null Het
Mis18bp1 T C 12: 65,158,694 T235A probably benign Het
Mta2 C T 19: 8,942,332 probably benign Het
Nebl T A 2: 17,452,510 I80F probably damaging Het
Nek10 A G 14: 14,860,764 T467A probably benign Het
Nexn A T 3: 152,252,939 F106I probably damaging Het
Nrd1 T A 4: 109,039,775 Y282* probably null Het
Nxf3 G A X: 136,075,834 P380S possibly damaging Het
Olfr1183 A G 2: 88,461,342 M1V probably null Het
Olfr1426 C A 19: 12,088,256 V179F probably damaging Het
Olfr403 T C 11: 74,196,163 V220A probably damaging Het
Olfr490 C A 7: 108,286,359 G256* probably null Het
Olfr495 A G 7: 108,395,834 Y238C probably benign Het
Olfr643 A T 7: 104,059,128 I158N possibly damaging Het
Olfr685 A T 7: 105,181,014 C115S probably damaging Het
Oma1 C T 4: 103,321,774 T208I probably damaging Het
Panx2 A T 15: 89,069,738 Y632F possibly damaging Het
Pdia4 T C 6: 47,796,655 T587A probably benign Het
Piezo2 A T 18: 63,074,662 L1426Q probably null Het
Pigk T A 3: 152,744,494 Y212N probably damaging Het
Prl3b1 C T 13: 27,245,792 T71I possibly damaging Het
Rab3gap1 A G 1: 127,942,429 E929G possibly damaging Het
Rabl3 T C 16: 37,563,717 I162T probably benign Het
Rasgrf2 T A 13: 92,035,965 T188S probably damaging Het
Slc12a2 A G 18: 57,910,286 I601V possibly damaging Het
Slc25a42 A T 8: 70,191,869 I60N probably benign Het
Slc2a3 C T 6: 122,736,735 G173S probably damaging Het
Slc46a3 G A 5: 147,886,594 T146M probably damaging Het
Specc1 C A 11: 62,029,294 P7T possibly damaging Het
Sptbn4 T C 7: 27,423,810 D229G probably benign Het
Sspo T C 6: 48,451,050 I154T probably benign Het
Stx5a T C 19: 8,748,890 probably null Het
Stxbp6 A T 12: 44,855,857 C210* probably null Het
Tagap1 C T 17: 6,956,886 R137Q probably benign Het
Tbc1d9 A G 8: 83,271,303 Y1163C probably damaging Het
Tex14 T G 11: 87,549,470 L1367R probably damaging Het
Tnnt3 C T 7: 142,511,525 R131C possibly damaging Het
Tpx2 T A 2: 152,890,624 M606K probably benign Het
Trim46 A T 3: 89,237,701 Y489N probably damaging Het
Ttc28 C T 5: 111,276,322 S1485L probably benign Het
Txnl1 T C 18: 63,679,514 T70A probably benign Het
Unc80 T C 1: 66,692,549 L3053P probably damaging Het
Wars G T 12: 108,888,433 N18K possibly damaging Het
Wnt8a A G 18: 34,544,884 D115G probably damaging Het
Xndc1 T A 7: 102,073,191 V21E probably damaging Het
Zfp493 T A 13: 67,786,269 C114S probably damaging Het
Other mutations in Glp1r
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Glp1r APN 17 30901917 missense possibly damaging 0.96
IGL00516:Glp1r APN 17 30925558 missense probably damaging 1.00
IGL00653:Glp1r APN 17 30930760 missense probably damaging 1.00
IGL00917:Glp1r APN 17 30919469 splice site probably benign
IGL02005:Glp1r APN 17 30924611 missense probably benign 0.03
IGL02411:Glp1r APN 17 30924511 missense probably damaging 1.00
IGL02889:Glp1r APN 17 30931144 splice site probably benign
IGL02928:Glp1r APN 17 30918937 missense probably benign 0.00
N/A:Glp1r UTSW 17 30931283 missense probably damaging 0.98
R0135:Glp1r UTSW 17 30924577 missense probably benign 0.00
R0395:Glp1r UTSW 17 30936338 missense probably benign 0.34
R0481:Glp1r UTSW 17 30931217 missense probably benign 0.03
R0602:Glp1r UTSW 17 30909227 missense probably benign 0.12
R0841:Glp1r UTSW 17 30919432 missense probably benign 0.01
R1145:Glp1r UTSW 17 30919432 missense probably benign 0.01
R1145:Glp1r UTSW 17 30919432 missense probably benign 0.01
R1232:Glp1r UTSW 17 30918931 missense probably benign
R1804:Glp1r UTSW 17 30930713 splice site probably null
R1846:Glp1r UTSW 17 30929935 critical splice acceptor site probably null
R1982:Glp1r UTSW 17 30925627 nonsense probably null
R2091:Glp1r UTSW 17 30925549 missense probably damaging 0.97
R3432:Glp1r UTSW 17 30924557 missense probably damaging 1.00
R4456:Glp1r UTSW 17 30918975 nonsense probably null
R4488:Glp1r UTSW 17 30918931 missense probably benign
R4610:Glp1r UTSW 17 30931247 missense probably benign 0.03
R4884:Glp1r UTSW 17 30936266 missense probably damaging 1.00
R5055:Glp1r UTSW 17 30918887 missense probably benign
R6358:Glp1r UTSW 17 30932644 missense probably benign 0.07
R6359:Glp1r UTSW 17 30929972 missense probably damaging 1.00
R6490:Glp1r UTSW 17 30924572 missense probably damaging 0.98
R6698:Glp1r UTSW 17 30936401 missense probably damaging 1.00
R7063:Glp1r UTSW 17 30925558 missense probably damaging 1.00
R7165:Glp1r UTSW 17 30909323 missense probably benign 0.23
R7293:Glp1r UTSW 17 30924625 missense probably benign 0.00
X0064:Glp1r UTSW 17 30919463 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ATTCTCTTTGCTATCGGCGTAAG -3'
(R):5'- AGACTTCAAAGGTCCAGGGG -3'

Sequencing Primer
(F):5'- TGCTATCGGCGTAAGTGACAG -3'
(R):5'- TCCAGGGGCTGCTAAGAATAG -3'
Posted On2014-08-25