Incidental Mutation 'R1990:Mta2'
ID225020
Institutional Source Beutler Lab
Gene Symbol Mta2
Ensembl Gene ENSMUSG00000071646
Gene Namemetastasis-associated gene family, member 2
SynonymsMta1l1, mmta2
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1990 (G1)
Quality Score123
Status Not validated
Chromosome19
Chromosomal Location8941875-8952303 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) C to T at 8942332 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000153061 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096240] [ENSMUST00000096241] [ENSMUST00000224272] [ENSMUST00000224642]
Predicted Effect probably benign
Transcript: ENSMUST00000096240
SMART Domains Protein: ENSMUSP00000093959
Gene: ENSMUSG00000071646

DomainStartEndE-ValueType
BAH 4 144 7.34e-34 SMART
ELM2 147 201 5.58e-15 SMART
SANT 264 313 2.24e-7 SMART
ZnF_GATA 361 415 5.5e-15 SMART
low complexity region 475 490 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000096241
SMART Domains Protein: ENSMUSP00000093960
Gene: ENSMUSG00000071647

DomainStartEndE-ValueType
coiled coil region 12 47 N/A INTRINSIC
low complexity region 96 108 N/A INTRINSIC
low complexity region 118 139 N/A INTRINSIC
low complexity region 149 168 N/A INTRINSIC
low complexity region 198 208 N/A INTRINSIC
Pfam:HELP 215 286 5.3e-30 PFAM
WD40 295 344 6.34e-2 SMART
Blast:WD40 347 392 5e-22 BLAST
WD40 395 434 1.56e-1 SMART
WD40 450 487 2.64e2 SMART
WD40 504 543 3.33e-1 SMART
WD40 587 626 2.69e-5 SMART
WD40 670 709 1.7e-2 SMART
WD40 716 755 1.52e-4 SMART
WD40 829 869 1.29e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132463
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135300
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137956
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151386
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169535
Predicted Effect probably benign
Transcript: ENSMUST00000224272
Predicted Effect probably benign
Transcript: ENSMUST00000224642
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225181
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225377
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226096
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that has been identified as a component of NuRD, a nucleosome remodeling deacetylase complex identified in the nucleus of human cells. It shows a very broad expression pattern and is strongly expressed in many tissues. It may represent one member of a small gene family that encode different but related proteins involved either directly or indirectly in transcriptional regulation. Their indirect effects on transcriptional regulation may include chromatin remodeling. It is closely related to another member of this family, a protein that has been correlated with the metastatic potential of certain carcinomas. These two proteins are so closely related that they share the same types of domains. These domains include two DNA binding domains, a dimerization domain, and a domain commonly found in proteins that methylate DNA. One of the proteins known to be a target protein for this gene product is p53. Deacetylation of p53 is correlated with a loss of growth inhibition in transformed cells supporting a connection between these gene family members and metastasis. [provided by RefSeq, May 2011]
PHENOTYPE: Mice homozygous for a null allele exhibit partial embryonic and perinatal lethality, reduced weight, shortened lifespan, and increased susceptibility to systemic lupus erythematosus with increased T cell proliferation under Th2 conditions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik C T 3: 138,065,658 R203* probably null Het
9530053A07Rik A T 7: 28,154,360 D1583V probably damaging Het
Acp6 T C 3: 97,175,738 L355P probably damaging Het
Aebp2 T C 6: 140,633,738 S234P probably damaging Het
Anapc7 A G 5: 122,439,504 D374G probably benign Het
Apob A T 12: 8,001,039 I1088F probably damaging Het
Arid4b T C 13: 14,132,436 V92A probably damaging Het
Armc3 T C 2: 19,293,142 Y575H probably damaging Het
Asxl2 G T 12: 3,484,558 G252* probably null Het
Atl1 A T 12: 69,963,328 K556M probably damaging Het
AU018091 A G 7: 3,162,264 V206A probably benign Het
Bcas1 A T 2: 170,370,477 D383E possibly damaging Het
Bmx A G X: 164,232,196 W257R probably benign Het
Bpifb6 T C 2: 153,905,350 probably null Het
Cacna1b G A 2: 24,732,306 P222L probably damaging Het
Cand1 A G 10: 119,210,067 S978P probably damaging Het
Cap2 T A 13: 46,637,881 Y175N possibly damaging Het
Caps2 G A 10: 112,200,686 A384T probably benign Het
Catsperg2 A T 7: 29,721,045 Y223* probably null Het
Cd81 G T 7: 143,067,201 G206* probably null Het
Cd84 A G 1: 171,872,750 T145A possibly damaging Het
Cdkn2aip G T 8: 47,712,176 N167K probably benign Het
Ceacam14 T A 7: 17,815,365 L227* probably null Het
Ceacam5 A T 7: 17,757,880 D725V probably damaging Het
Cldn34a A T X: 152,563,845 H171L probably benign Het
Col18a1 T C 10: 77,081,154 I114V unknown Het
Cp A G 3: 19,979,013 D667G probably damaging Het
Cr2 G A 1: 195,154,150 P1278S possibly damaging Het
Crat A G 2: 30,405,048 Y452H possibly damaging Het
Cyp4f13 T A 17: 32,925,568 H318L probably damaging Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dmbt1 A G 7: 131,058,288 N527S probably damaging Het
Fgb G T 3: 83,044,253 Y256* probably null Het
Frmd3 T A 4: 74,187,439 S441T probably damaging Het
Glp1r T A 17: 30,930,748 C329S possibly damaging Het
Gm13088 T A 4: 143,654,268 Y395F probably damaging Het
Gm13757 A G 2: 88,446,689 L83P probably damaging Het
Gm14190 G T 11: 99,690,605 Q46K unknown Het
Golt1b T A 6: 142,392,354 F17Y probably damaging Het
Gsdmc A G 15: 63,801,899 I179T probably benign Het
Gsdmc2 T A 15: 63,828,237 M229L probably benign Het
Gulp1 A C 1: 44,766,114 N121T possibly damaging Het
Ift122 T A 6: 115,924,367 F1037I probably damaging Het
Ildr1 A T 16: 36,716,206 Y199F probably damaging Het
Ints2 T A 11: 86,248,934 H278L possibly damaging Het
Invs T C 4: 48,392,599 V271A possibly damaging Het
Kcnj2 T C 11: 111,072,883 I367T probably benign Het
Kif21b T C 1: 136,161,770 S1115P probably damaging Het
Lce1k A T 3: 92,806,818 C20S unknown Het
Lcmt2 C A 2: 121,140,281 R107L probably benign Het
Letm1 A AG 5: 33,769,515 probably null Het
Lrrc9 A C 12: 72,497,861 R71S probably damaging Het
Mcc C A 18: 44,491,315 E213* probably null Het
Mis18bp1 T C 12: 65,158,694 T235A probably benign Het
Nebl T A 2: 17,452,510 I80F probably damaging Het
Nek10 A G 14: 14,860,764 T467A probably benign Het
Nexn A T 3: 152,252,939 F106I probably damaging Het
Nrd1 T A 4: 109,039,775 Y282* probably null Het
Nxf3 G A X: 136,075,834 P380S possibly damaging Het
Olfr1183 A G 2: 88,461,342 M1V probably null Het
Olfr1426 C A 19: 12,088,256 V179F probably damaging Het
Olfr403 T C 11: 74,196,163 V220A probably damaging Het
Olfr490 C A 7: 108,286,359 G256* probably null Het
Olfr495 A G 7: 108,395,834 Y238C probably benign Het
Olfr643 A T 7: 104,059,128 I158N possibly damaging Het
Olfr685 A T 7: 105,181,014 C115S probably damaging Het
Oma1 C T 4: 103,321,774 T208I probably damaging Het
Panx2 A T 15: 89,069,738 Y632F possibly damaging Het
Pdia4 T C 6: 47,796,655 T587A probably benign Het
Piezo2 A T 18: 63,074,662 L1426Q probably null Het
Pigk T A 3: 152,744,494 Y212N probably damaging Het
Prl3b1 C T 13: 27,245,792 T71I possibly damaging Het
Rab3gap1 A G 1: 127,942,429 E929G possibly damaging Het
Rabl3 T C 16: 37,563,717 I162T probably benign Het
Rasgrf2 T A 13: 92,035,965 T188S probably damaging Het
Slc12a2 A G 18: 57,910,286 I601V possibly damaging Het
Slc25a42 A T 8: 70,191,869 I60N probably benign Het
Slc2a3 C T 6: 122,736,735 G173S probably damaging Het
Slc46a3 G A 5: 147,886,594 T146M probably damaging Het
Specc1 C A 11: 62,029,294 P7T possibly damaging Het
Sptbn4 T C 7: 27,423,810 D229G probably benign Het
Sspo T C 6: 48,451,050 I154T probably benign Het
Stx5a T C 19: 8,748,890 probably null Het
Stxbp6 A T 12: 44,855,857 C210* probably null Het
Tagap1 C T 17: 6,956,886 R137Q probably benign Het
Tbc1d9 A G 8: 83,271,303 Y1163C probably damaging Het
Tex14 T G 11: 87,549,470 L1367R probably damaging Het
Tnnt3 C T 7: 142,511,525 R131C possibly damaging Het
Tpx2 T A 2: 152,890,624 M606K probably benign Het
Trim46 A T 3: 89,237,701 Y489N probably damaging Het
Ttc28 C T 5: 111,276,322 S1485L probably benign Het
Txnl1 T C 18: 63,679,514 T70A probably benign Het
Unc80 T C 1: 66,692,549 L3053P probably damaging Het
Wars G T 12: 108,888,433 N18K possibly damaging Het
Wnt8a A G 18: 34,544,884 D115G probably damaging Het
Xndc1 T A 7: 102,073,191 V21E probably damaging Het
Zfp493 T A 13: 67,786,269 C114S probably damaging Het
Other mutations in Mta2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00916:Mta2 APN 19 8947101 missense probably benign 0.23
IGL01098:Mta2 APN 19 8946717 missense probably damaging 0.98
IGL01148:Mta2 APN 19 8948304 missense probably damaging 0.98
IGL01897:Mta2 APN 19 8947766 nonsense probably null
IGL02054:Mta2 APN 19 8950912 missense probably benign
IGL02157:Mta2 APN 19 8947249 splice site probably benign
IGL02452:Mta2 APN 19 8950306 missense probably benign 0.00
IGL02563:Mta2 APN 19 8948051 missense probably benign
IGL02626:Mta2 APN 19 8949168 missense probably damaging 1.00
IGL02695:Mta2 APN 19 8948364 missense probably benign 0.01
R1208:Mta2 UTSW 19 8951017 missense probably damaging 1.00
R1208:Mta2 UTSW 19 8951017 missense probably damaging 1.00
R1301:Mta2 UTSW 19 8949186 splice site probably benign
R1731:Mta2 UTSW 19 8947724 splice site probably null
R2116:Mta2 UTSW 19 8943516 missense probably damaging 1.00
R2117:Mta2 UTSW 19 8943516 missense probably damaging 1.00
R4614:Mta2 UTSW 19 8948128 splice site probably null
R4710:Mta2 UTSW 19 8949153 missense probably damaging 1.00
R4801:Mta2 UTSW 19 8945851 missense probably damaging 1.00
R4802:Mta2 UTSW 19 8945851 missense probably damaging 1.00
R4947:Mta2 UTSW 19 8946291 missense possibly damaging 0.68
R4999:Mta2 UTSW 19 8950383 missense probably benign
R5340:Mta2 UTSW 19 8942356 start codon destroyed probably null 0.89
R5518:Mta2 UTSW 19 8948092 missense probably benign 0.01
R6044:Mta2 UTSW 19 8948331 missense probably damaging 0.99
R7096:Mta2 UTSW 19 8947775 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGCTATAGCAGTGTCGTCGTC -3'
(R):5'- TAAGCCTCTGCGGTAGACTC -3'

Sequencing Primer
(F):5'- ATCGACACTTCCGCGAAGC -3'
(R):5'- GGAACCATGGCTCTTGATTCCG -3'
Posted On2014-08-25