Incidental Mutation 'R1991:Ush2a'
ID225054
Institutional Source Beutler Lab
Gene Symbol Ush2a
Ensembl Gene ENSMUSG00000026609
Gene Nameusherin
SynonymsA930011D15Rik, LOC381317, A930037M10Rik, LOC269160, Usherin, MUSH2A
MMRRC Submission 040002-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.491) question?
Stock #R1991 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location188262023-188965041 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) C to T at 188578532 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000050454 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060479]
Predicted Effect probably benign
Transcript: ENSMUST00000060479
SMART Domains Protein: ENSMUSP00000050454
Gene: ENSMUSG00000026609

DomainStartEndE-ValueType
transmembrane domain 9 31 N/A INTRINSIC
Pfam:Laminin_G_3 128 283 6.5e-16 PFAM
LamNT 310 513 6.79e-9 SMART
EGF_Lam 515 569 1.58e-3 SMART
EGF_Lam 572 635 5.69e-10 SMART
EGF_Lam 638 688 4.38e-11 SMART
EGF_Lam 691 741 3.56e-11 SMART
EGF_Lam 744 789 7.93e-9 SMART
EGF_Lam 792 841 3.37e-12 SMART
EGF_Lam 844 894 2.01e-10 SMART
EGF_Lam 897 945 5.43e-16 SMART
EGF_Lam 948 996 7.88e-4 SMART
EGF_Lam 999 1047 2.96e-8 SMART
FN3 1051 1130 1e-1 SMART
FN3 1145 1224 2.06e-3 SMART
FN3 1239 1342 8.69e-11 SMART
FN3 1356 1447 5.32e-6 SMART
FN3 1461 1570 2.63e1 SMART
LamG 1531 1672 5.39e-19 SMART
LamG 1727 1862 2.33e-23 SMART
FN3 1861 1931 9.15e1 SMART
FN3 1945 2032 2.24e-4 SMART
FN3 2047 2120 1.13e0 SMART
FN3 2134 2218 3.4e-4 SMART
FN3 2232 2306 1.59e-4 SMART
FN3 2320 2412 1.12e-4 SMART
FN3 2423 2510 8.9e-8 SMART
FN3 2524 2600 1.95e-4 SMART
FN3 2612 2701 4.67e-2 SMART
FN3 2715 2792 1.17e-7 SMART
FN3 2809 2902 1.12e-4 SMART
FN3 2913 2997 5.36e-2 SMART
FN3 3011 3089 2.46e-1 SMART
FN3 3101 3477 2.85e1 SMART
FN3 3491 3568 4e-1 SMART
FN3 3582 3659 5.87e-8 SMART
FN3 3673 3750 1.75e-6 SMART
FN3 3764 3845 9.62e-4 SMART
FN3 3859 3943 2.41e-4 SMART
FN3 3954 4044 5.11e-8 SMART
FN3 4058 4133 1.06e0 SMART
FN3 4147 4241 7.87e-9 SMART
FN3 4255 4334 1.15e-1 SMART
FN3 4348 4422 6.39e-9 SMART
FN3 4435 4510 6.91e-5 SMART
FN3 4521 4610 2.28e-5 SMART
FN3 4626 4713 1.71e0 SMART
FN3 4724 4805 1.3e0 SMART
FN3 4817 4909 3.62e-8 SMART
transmembrane domain 5032 5054 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142159
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.3%
Validation Efficiency 100% (124/124)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that contains laminin EGF motifs, a pentaxin domain, and many fibronectin type III motifs. The protein is found in the basement membrane, and may be important in development and homeostasis of the inner ear and retina. Mutations within this gene have been associated with Usher syndrome type IIa and retinitis pigmentosa. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2008]
PHENOTYPE: Mice homozygous for a knock-out allele display progressive retinal photoreceptor degeneration along with significantly reduced a- and b-wave amplitudes, and a moderate but nonprogressive high-frequency hearing loss associated with widespread loss of outer hair cells in the basal turn of the cochlea. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 123 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik C T 3: 138,065,658 R203* probably null Het
Abcc2 A T 19: 43,807,142 I446F probably damaging Het
Afap1l2 A T 19: 57,002,267 I18N possibly damaging Het
Aida A T 1: 183,313,692 E107D probably benign Het
Amer2 A G 14: 60,379,820 Y362C probably damaging Het
Amigo1 T C 3: 108,187,328 S48P probably benign Het
Ano5 A G 7: 51,537,813 K50R possibly damaging Het
Anxa2 A T 9: 69,483,816 D95V probably damaging Het
Arhgap22 A G 14: 33,366,959 N466D probably damaging Het
Armc3 T C 2: 19,293,142 Y575H probably damaging Het
Ascc2 A G 11: 4,679,257 E523G probably benign Het
B3galt5 A T 16: 96,316,025 K286M probably damaging Het
Bag3 C T 7: 128,545,683 H341Y probably benign Het
Blm G T 7: 80,505,949 probably null Het
Cacna1b G A 2: 24,732,306 P222L probably damaging Het
Cap2 T A 13: 46,637,881 Y175N possibly damaging Het
Cd81 G T 7: 143,067,201 G206* probably null Het
Cep290 T A 10: 100,531,184 S1132R possibly damaging Het
Cluh C A 11: 74,659,529 C222* probably null Het
Col14a1 A T 15: 55,449,940 D1320V unknown Het
Col18a1 T C 10: 77,081,154 I114V unknown Het
Cped1 A G 6: 22,233,927 T847A probably damaging Het
Cpne7 A G 8: 123,127,437 K288E possibly damaging Het
Cr2 G A 1: 195,154,150 P1278S possibly damaging Het
Creb3 C A 4: 43,565,327 R202S probably damaging Het
Cyp2j9 T A 4: 96,571,964 K434M probably damaging Het
Dpp10 A T 1: 123,905,106 V48E probably null Het
Dsg2 A G 18: 20,601,473 K836R probably damaging Het
Dst A G 1: 34,190,258 T1986A probably benign Het
Dvl1 G A 4: 155,847,816 V28I possibly damaging Het
Ecm2 A G 13: 49,530,256 D570G probably benign Het
Efhc1 T A 1: 20,989,560 C611* probably null Het
Epop T C 11: 97,628,654 T210A probably benign Het
Erc2 A G 14: 28,011,636 I556V probably benign Het
Fdxacb1 A T 9: 50,771,646 N101I probably benign Het
Fhad1 T C 4: 141,982,162 S294G possibly damaging Het
Galnt16 A G 12: 80,583,656 D262G probably damaging Het
Gm9573 A T 17: 35,618,708 S1529T probably benign Het
Gorab A G 1: 163,397,056 S59P probably damaging Het
Gpr161 G T 1: 165,306,563 M131I probably damaging Het
Gpr22 T A 12: 31,709,203 M270L probably benign Het
Grin3b C A 10: 79,970,912 Q5K probably benign Het
Grin3b C T 10: 79,974,646 A662V probably damaging Het
Gsdmc A G 15: 63,801,899 I179T probably benign Het
Gsdmc2 T A 15: 63,828,237 M229L probably benign Het
H2-Eb2 A G 17: 34,334,304 I155V probably benign Het
Hoga1 A C 19: 42,060,020 probably null Het
Hs3st5 A G 10: 36,832,886 Y139C probably damaging Het
Il10ra C A 9: 45,255,811 A481S probably benign Het
Ints2 T A 11: 86,248,934 H278L possibly damaging Het
Kalrn T G 16: 33,975,738 L1222F probably damaging Het
Klhl25 T A 7: 75,866,732 V157D probably damaging Het
Klk1b26 A T 7: 44,016,900 T256S probably damaging Het
Krt81 T C 15: 101,462,554 Q184R probably benign Het
Lce1k A T 3: 92,806,818 C20S unknown Het
Letm1 A AG 5: 33,769,515 probably null Het
Lin54 A G 5: 100,485,801 probably null Het
Lrrc37a T C 11: 103,500,261 E1446G probably benign Het
Macf1 A G 4: 123,456,695 S3792P probably damaging Het
Manba T A 3: 135,551,191 D538E probably benign Het
Mcc C A 18: 44,491,315 E213* probably null Het
Mfap4 T C 11: 61,485,807 probably null Het
Nebl T A 2: 17,452,510 I80F probably damaging Het
Nek4 A G 14: 30,956,953 I145V probably damaging Het
Nlrp14 T C 7: 107,196,200 V230A probably benign Het
Nxf3 G A X: 136,075,834 P380S possibly damaging Het
Olfr1451 T C 19: 12,999,502 V172A possibly damaging Het
Olfr403 T C 11: 74,196,163 V220A probably damaging Het
Olfr421-ps1 C T 1: 174,152,121 H202Y probably damaging Het
Olfr490 C A 7: 108,286,359 G256* probably null Het
Olfr745 G A 14: 50,642,866 C195Y possibly damaging Het
Pcdhb13 C T 18: 37,443,859 T430I possibly damaging Het
Piezo2 A T 18: 63,074,662 L1426Q probably null Het
Pigk T A 3: 152,744,494 Y212N probably damaging Het
Pigm T G 1: 172,377,261 L188R probably damaging Het
Plce1 T C 19: 38,777,924 F2117S probably damaging Het
Plec A G 15: 76,173,543 F4055L probably damaging Het
Plk5 C T 10: 80,363,102 S435L possibly damaging Het
Pms1 G A 1: 53,282,042 L11F probably damaging Het
Prl3b1 C T 13: 27,247,912 T140I possibly damaging Het
Prl7a1 T G 13: 27,633,672 D203A probably damaging Het
Psg17 A G 7: 18,814,652 V398A probably benign Het
Pum1 T A 4: 130,718,218 I166K possibly damaging Het
R3hdm1 T A 1: 128,169,016 D108E probably damaging Het
Reln A T 5: 21,969,360 D1948E possibly damaging Het
Rnf112 C T 11: 61,452,426 R141Q probably damaging Het
Rnf145 T C 11: 44,561,466 V424A possibly damaging Het
Serpina3m C A 12: 104,389,699 Y208* probably null Het
Serpind1 T C 16: 17,342,944 V446A probably benign Het
Shc3 T A 13: 51,442,836 M384L probably benign Het
Slc38a11 A G 2: 65,330,339 F304L probably benign Het
Slpi C T 2: 164,355,543 C28Y probably damaging Het
Specc1 C A 11: 62,029,294 P7T possibly damaging Het
Spib T C 7: 44,528,857 E180G probably benign Het
Spint5 T C 2: 164,716,983 probably benign Het
Ssr2 T A 3: 88,576,867 probably benign Het
Tbrg1 T C 9: 37,649,419 D387G probably benign Het
Tex14 T G 11: 87,549,470 L1367R probably damaging Het
Tfpi A C 2: 84,458,016 probably benign Het
Tlr5 T A 1: 182,974,347 D405E probably damaging Het
Tnnt3 C T 7: 142,511,525 R131C possibly damaging Het
Tnxb T C 17: 34,671,904 V407A probably damaging Het
Tnxb A G 17: 34,682,251 Y1013C probably damaging Het
Tpx2 T A 2: 152,890,624 M606K probably benign Het
Trim30a T A 7: 104,430,230 probably benign Het
Trim46 A T 3: 89,237,701 Y489N probably damaging Het
Trpm6 A T 19: 18,796,284 H380L probably benign Het
Tstd2 A G 4: 46,120,563 I279T probably benign Het
Ttn C T 2: 76,946,391 probably null Het
Txnl1 T C 18: 63,679,514 T70A probably benign Het
Usp1 A G 4: 98,934,294 D615G probably benign Het
Virma T A 4: 11,519,242 C830S probably benign Het
Vmn1r7 A T 6: 57,024,868 S136T probably benign Het
Vmn2r9 A G 5: 108,846,439 V448A probably damaging Het
Vps11 G A 9: 44,359,227 H183Y probably damaging Het
Vsig10l A G 7: 43,467,468 T476A possibly damaging Het
Wdr63 G T 3: 146,063,480 T522K possibly damaging Het
Whamm C T 7: 81,591,771 R277* probably null Het
Wnt8a A G 18: 34,544,884 D115G probably damaging Het
Xndc1 T A 7: 102,073,191 V21E probably damaging Het
Zc3hav1 C A 6: 38,336,517 V198L probably damaging Het
Zfp874a T A 13: 67,442,504 I354F probably benign Het
Zfr2 A T 10: 81,242,852 D306V possibly damaging Het
Other mutations in Ush2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Ush2a APN 1 188864678 missense probably benign 0.00
IGL00391:Ush2a APN 1 188916061 missense probably damaging 1.00
IGL00429:Ush2a APN 1 188400114 nonsense probably null
IGL00484:Ush2a APN 1 188782513 missense probably benign 0.00
IGL00519:Ush2a APN 1 188444668 missense probably benign 0.03
IGL00567:Ush2a APN 1 188964917 missense probably damaging 1.00
IGL00823:Ush2a APN 1 188911443 missense possibly damaging 0.61
IGL00940:Ush2a APN 1 188357961 nonsense probably null
IGL00951:Ush2a APN 1 188263465 missense probably benign 0.33
IGL00956:Ush2a APN 1 188753522 missense probably damaging 0.99
IGL01096:Ush2a APN 1 188678377 missense probably damaging 1.00
IGL01108:Ush2a APN 1 188862825 missense probably benign 0.00
IGL01315:Ush2a APN 1 188633614 missense possibly damaging 0.51
IGL01318:Ush2a APN 1 188814353 missense probably benign 0.00
IGL01324:Ush2a APN 1 188848992 missense probably benign 0.38
IGL01326:Ush2a APN 1 188263321 nonsense probably null
IGL01384:Ush2a APN 1 188553228 missense possibly damaging 0.65
IGL01466:Ush2a APN 1 188911622 missense probably benign 0.00
IGL01518:Ush2a APN 1 188399785 missense probably benign 0.01
IGL01585:Ush2a APN 1 188430727 missense probably damaging 1.00
IGL01595:Ush2a APN 1 188654724 critical splice donor site probably null
IGL01657:Ush2a APN 1 188826461 missense probably benign 0.03
IGL01797:Ush2a APN 1 188263509 missense probably damaging 1.00
IGL01802:Ush2a APN 1 188436957 missense probably damaging 0.99
IGL01836:Ush2a APN 1 188759863 splice site probably benign
IGL01938:Ush2a APN 1 188797845 missense probably damaging 1.00
IGL01976:Ush2a APN 1 188911241 missense probably benign 0.04
IGL02023:Ush2a APN 1 188733514 missense probably benign 0.03
IGL02126:Ush2a APN 1 188263391 missense probably benign 0.01
IGL02133:Ush2a APN 1 188443343 missense probably damaging 1.00
IGL02147:Ush2a APN 1 188864703 missense probably benign
IGL02275:Ush2a APN 1 188263269 missense possibly damaging 0.67
IGL02314:Ush2a APN 1 188633629 missense probably benign 0.00
IGL02353:Ush2a APN 1 188728438 missense probably benign 0.04
IGL02360:Ush2a APN 1 188728438 missense probably benign 0.04
IGL02367:Ush2a APN 1 188784746 missense probably benign
IGL02402:Ush2a APN 1 188267108 missense probably benign 0.02
IGL02410:Ush2a APN 1 188915997 missense probably damaging 1.00
IGL02490:Ush2a APN 1 188810364 missense probably damaging 1.00
IGL02500:Ush2a APN 1 188822696 missense probably damaging 1.00
IGL02511:Ush2a APN 1 188743687 critical splice donor site probably null
IGL02517:Ush2a APN 1 188915998 missense probably damaging 1.00
IGL02536:Ush2a APN 1 188957266 critical splice acceptor site probably null
IGL02585:Ush2a APN 1 188728333 missense probably benign 0.00
IGL02610:Ush2a APN 1 188444466 missense probably damaging 0.98
IGL02677:Ush2a APN 1 188734685 missense probably damaging 1.00
IGL02691:Ush2a APN 1 188734752 missense probably damaging 1.00
IGL02740:Ush2a APN 1 188648388 missense possibly damaging 0.68
IGL02744:Ush2a APN 1 188358717 splice site probably null
IGL02749:Ush2a APN 1 188946958 missense probably damaging 0.99
IGL02806:Ush2a APN 1 188810357 nonsense probably null
IGL02870:Ush2a APN 1 188678358 missense probably benign 0.42
IGL02894:Ush2a APN 1 188451846 missense probably damaging 1.00
IGL02904:Ush2a APN 1 188906506 missense probably benign 0.06
IGL03000:Ush2a APN 1 188549856 missense possibly damaging 0.81
IGL03015:Ush2a APN 1 188436950 missense probably benign 0.01
IGL03036:Ush2a APN 1 188864621 missense possibly damaging 0.80
IGL03057:Ush2a APN 1 188797838 missense probably damaging 1.00
IGL03230:Ush2a APN 1 188466193 missense probably benign 0.09
IGL03278:Ush2a APN 1 188849116 missense probably damaging 1.00
PIT4283001:Ush2a UTSW 1 188436867 missense probably benign 0.01
R0003:Ush2a UTSW 1 188578491 missense probably damaging 0.99
R0030:Ush2a UTSW 1 188822657 missense possibly damaging 0.51
R0035:Ush2a UTSW 1 188356888 missense probably benign
R0038:Ush2a UTSW 1 188626612 missense probably benign 0.00
R0038:Ush2a UTSW 1 188626612 missense probably benign 0.00
R0067:Ush2a UTSW 1 188964846 missense probably damaging 0.99
R0067:Ush2a UTSW 1 188964846 missense probably damaging 0.99
R0103:Ush2a UTSW 1 188319070 missense possibly damaging 0.81
R0103:Ush2a UTSW 1 188319070 missense possibly damaging 0.81
R0122:Ush2a UTSW 1 188948455 missense possibly damaging 0.65
R0206:Ush2a UTSW 1 188531761 missense probably damaging 0.99
R0208:Ush2a UTSW 1 188531761 missense probably damaging 0.99
R0230:Ush2a UTSW 1 188850104 missense probably damaging 1.00
R0269:Ush2a UTSW 1 188810176 missense probably benign 0.33
R0319:Ush2a UTSW 1 188948374 splice site probably benign
R0358:Ush2a UTSW 1 188537780 missense possibly damaging 0.83
R0379:Ush2a UTSW 1 188451819 missense probably damaging 1.00
R0427:Ush2a UTSW 1 188400281 missense probably damaging 1.00
R0437:Ush2a UTSW 1 188911031 missense probably benign 0.00
R0462:Ush2a UTSW 1 188910939 missense probably benign
R0510:Ush2a UTSW 1 188734663 splice site probably benign
R0531:Ush2a UTSW 1 188443181 missense probably benign 0.18
R0541:Ush2a UTSW 1 188714466 splice site probably benign
R0549:Ush2a UTSW 1 188946953 missense probably damaging 0.99
R0562:Ush2a UTSW 1 188356847 missense probably damaging 1.00
R0636:Ush2a UTSW 1 188822738 missense probably benign
R0662:Ush2a UTSW 1 188351093 missense probably benign 0.26
R0685:Ush2a UTSW 1 188400278 missense probably damaging 1.00
R0718:Ush2a UTSW 1 188797830 missense probably damaging 1.00
R0725:Ush2a UTSW 1 188951525 missense probably damaging 1.00
R0735:Ush2a UTSW 1 188864693 missense probably benign 0.04
R0744:Ush2a UTSW 1 188814406 splice site probably benign
R0765:Ush2a UTSW 1 188948574 missense possibly damaging 0.67
R0862:Ush2a UTSW 1 188542818 nonsense probably null
R1067:Ush2a UTSW 1 188550207 missense probably benign 0.35
R1072:Ush2a UTSW 1 188728717 missense possibly damaging 0.91
R1099:Ush2a UTSW 1 188648348 missense probably benign 0.06
R1099:Ush2a UTSW 1 188864639 missense probably damaging 1.00
R1104:Ush2a UTSW 1 188916256 missense probably benign
R1106:Ush2a UTSW 1 188910983 missense possibly damaging 0.82
R1124:Ush2a UTSW 1 188753536 missense probably damaging 0.99
R1168:Ush2a UTSW 1 188678411 missense probably benign 0.01
R1199:Ush2a UTSW 1 188759795 missense probably benign 0.00
R1215:Ush2a UTSW 1 188957282 missense possibly damaging 0.66
R1307:Ush2a UTSW 1 188357967 missense probably damaging 1.00
R1307:Ush2a UTSW 1 188451840 missense probably damaging 1.00
R1311:Ush2a UTSW 1 188947145 missense possibly damaging 0.86
R1388:Ush2a UTSW 1 188523318 splice site probably benign
R1416:Ush2a UTSW 1 188436883 missense probably damaging 1.00
R1424:Ush2a UTSW 1 188542878 critical splice donor site probably null
R1459:Ush2a UTSW 1 188862851 missense probably benign 0.05
R1470:Ush2a UTSW 1 188400206 missense probably benign 0.00
R1470:Ush2a UTSW 1 188400206 missense probably benign 0.00
R1477:Ush2a UTSW 1 188849076 missense probably benign 0.05
R1484:Ush2a UTSW 1 188810337 nonsense probably null
R1490:Ush2a UTSW 1 188359841 missense probably benign 0.24
R1510:Ush2a UTSW 1 188648304 missense probably damaging 1.00
R1522:Ush2a UTSW 1 188797814 missense possibly damaging 0.94
R1606:Ush2a UTSW 1 188759766 missense probably benign 0.17
R1618:Ush2a UTSW 1 188814224 missense probably benign 0.29
R1636:Ush2a UTSW 1 188466176 missense possibly damaging 0.53
R1646:Ush2a UTSW 1 188415821 missense probably damaging 1.00
R1660:Ush2a UTSW 1 188916064 missense probably benign
R1676:Ush2a UTSW 1 188728585 missense probably damaging 1.00
R1704:Ush2a UTSW 1 188821796 missense probably damaging 1.00
R1705:Ush2a UTSW 1 188874869 missense probably damaging 1.00
R1705:Ush2a UTSW 1 188911541 missense probably benign 0.40
R1760:Ush2a UTSW 1 188910983 missense possibly damaging 0.82
R1776:Ush2a UTSW 1 188728203 missense possibly damaging 0.83
R1782:Ush2a UTSW 1 188911185 missense probably benign 0.06
R1794:Ush2a UTSW 1 188862809 missense probably benign 0.00
R1796:Ush2a UTSW 1 188910827 missense probably benign 0.11
R1804:Ush2a UTSW 1 188633729 critical splice donor site probably null
R1835:Ush2a UTSW 1 188451818 missense probably benign 0.13
R1871:Ush2a UTSW 1 188826468 missense probably benign 0.02
R1876:Ush2a UTSW 1 188678289 missense possibly damaging 0.51
R1887:Ush2a UTSW 1 188399980 missense probably benign 0.05
R1896:Ush2a UTSW 1 188550009 missense probably benign 0.00
R1907:Ush2a UTSW 1 188715064 missense probably benign 0.01
R1940:Ush2a UTSW 1 188951561 missense probably null 0.89
R1950:Ush2a UTSW 1 188755185 missense probably damaging 1.00
R2043:Ush2a UTSW 1 188916256 missense probably benign 0.00
R2046:Ush2a UTSW 1 188356927 missense probably benign 0.01
R2059:Ush2a UTSW 1 188381549 critical splice donor site probably null
R2239:Ush2a UTSW 1 188576214 missense probably benign
R2365:Ush2a UTSW 1 188378991 missense possibly damaging 0.68
R2395:Ush2a UTSW 1 188947040 missense probably damaging 1.00
R2425:Ush2a UTSW 1 188537804 missense possibly damaging 0.82
R2519:Ush2a UTSW 1 188267107 missense probably benign
R3039:Ush2a UTSW 1 188911547 missense probably damaging 0.99
R3434:Ush2a UTSW 1 188733758 missense probably damaging 1.00
R3711:Ush2a UTSW 1 188810292 missense probably benign 0.05
R3712:Ush2a UTSW 1 188810292 missense probably benign 0.05
R3732:Ush2a UTSW 1 188944760 missense probably benign 0.16
R3746:Ush2a UTSW 1 188810292 missense probably benign 0.05
R3747:Ush2a UTSW 1 188810292 missense probably benign 0.05
R3883:Ush2a UTSW 1 188263382 missense probably benign
R3911:Ush2a UTSW 1 188399954 missense probably benign 0.05
R3934:Ush2a UTSW 1 188263511 critical splice donor site probably null
R3946:Ush2a UTSW 1 188728504 missense probably benign 0.01
R3974:Ush2a UTSW 1 188381501 missense probably benign 0.06
R4158:Ush2a UTSW 1 188728710 missense probably damaging 1.00
R4159:Ush2a UTSW 1 188728710 missense probably damaging 1.00
R4161:Ush2a UTSW 1 188728710 missense probably damaging 1.00
R4162:Ush2a UTSW 1 188743680 missense probably benign 0.00
R4255:Ush2a UTSW 1 188759843 nonsense probably null
R4280:Ush2a UTSW 1 188578461 missense probably benign 0.16
R4387:Ush2a UTSW 1 188443431 missense probably benign 0.00
R4416:Ush2a UTSW 1 188356874 missense probably damaging 0.97
R4494:Ush2a UTSW 1 188553276 missense possibly damaging 0.50
R4505:Ush2a UTSW 1 188728596 missense possibly damaging 0.92
R4522:Ush2a UTSW 1 188864625 missense probably damaging 1.00
R4584:Ush2a UTSW 1 188451798 missense probably benign 0.00
R4599:Ush2a UTSW 1 188911647 missense probably benign 0.01
R4605:Ush2a UTSW 1 188910801 missense probably damaging 1.00
R4632:Ush2a UTSW 1 188395874 missense possibly damaging 0.82
R4688:Ush2a UTSW 1 188399941 missense probably benign 0.01
R4751:Ush2a UTSW 1 188850087 missense probably damaging 0.98
R4770:Ush2a UTSW 1 188549879 missense probably benign 0.25
R4771:Ush2a UTSW 1 188797769 missense possibly damaging 0.92
R4798:Ush2a UTSW 1 188743545 missense probably damaging 1.00
R4821:Ush2a UTSW 1 188753651 missense probably benign 0.32
R4857:Ush2a UTSW 1 188537720 missense probably benign 0.01
R4860:Ush2a UTSW 1 188553275 missense probably benign 0.07
R4860:Ush2a UTSW 1 188553275 missense probably benign 0.07
R4898:Ush2a UTSW 1 188626608 missense probably benign 0.37
R4993:Ush2a UTSW 1 188910720 missense probably benign 0.03
R5035:Ush2a UTSW 1 188910808 missense probably damaging 1.00
R5061:Ush2a UTSW 1 188957274 missense probably benign 0.03
R5150:Ush2a UTSW 1 188451870 missense possibly damaging 0.95
R5205:Ush2a UTSW 1 188874936 missense probably benign 0.21
R5212:Ush2a UTSW 1 188444705 critical splice donor site probably null
R5252:Ush2a UTSW 1 188821717 missense possibly damaging 0.83
R5260:Ush2a UTSW 1 188947079 missense possibly damaging 0.95
R5304:Ush2a UTSW 1 188356798 missense probably damaging 0.99
R5323:Ush2a UTSW 1 188821677 critical splice acceptor site probably null
R5330:Ush2a UTSW 1 188728381 missense probably benign 0.00
R5331:Ush2a UTSW 1 188728381 missense probably benign 0.00
R5332:Ush2a UTSW 1 188351079 missense probably damaging 1.00
R5371:Ush2a UTSW 1 188443070 missense probably benign 0.00
R5374:Ush2a UTSW 1 188755206 missense probably benign
R5377:Ush2a UTSW 1 188912123 missense probably benign 0.00
R5525:Ush2a UTSW 1 188753606 missense probably benign 0.01
R5558:Ush2a UTSW 1 188797827 missense possibly damaging 0.47
R5562:Ush2a UTSW 1 188576217 missense probably damaging 1.00
R5595:Ush2a UTSW 1 188906498 missense possibly damaging 0.95
R5620:Ush2a UTSW 1 188759823 missense possibly damaging 0.82
R5714:Ush2a UTSW 1 188400257 missense probably benign 0.00
R5743:Ush2a UTSW 1 188436962 missense probably benign 0.01
R5779:Ush2a UTSW 1 188443510 critical splice donor site probably null
R5795:Ush2a UTSW 1 188443397 missense probably benign 0.34
R5897:Ush2a UTSW 1 188821738 missense probably damaging 1.00
R5918:Ush2a UTSW 1 188356814 missense probably benign 0.26
R6000:Ush2a UTSW 1 188267026 nonsense probably null
R6014:Ush2a UTSW 1 188850040 missense probably damaging 0.98
R6017:Ush2a UTSW 1 188957514 critical splice donor site probably null
R6020:Ush2a UTSW 1 188728096 splice site probably null
R6039:Ush2a UTSW 1 188319020 missense possibly damaging 0.76
R6039:Ush2a UTSW 1 188319020 missense possibly damaging 0.76
R6050:Ush2a UTSW 1 188957324 missense probably benign 0.06
R6083:Ush2a UTSW 1 188267023 missense probably damaging 1.00
R6091:Ush2a UTSW 1 188399803 missense probably damaging 1.00
R6120:Ush2a UTSW 1 188358603 missense probably benign 0.04
R6135:Ush2a UTSW 1 188912106 missense possibly damaging 0.68
R6141:Ush2a UTSW 1 188357963 missense possibly damaging 0.71
R6157:Ush2a UTSW 1 188728270 missense probably benign 0.00
R6180:Ush2a UTSW 1 188399871 nonsense probably null
R6191:Ush2a UTSW 1 188263101 nonsense probably null
R6217:Ush2a UTSW 1 188743454 intron probably null
R6263:Ush2a UTSW 1 188358642 missense probably damaging 1.00
R6294:Ush2a UTSW 1 188536370 missense possibly damaging 0.49
R6320:Ush2a UTSW 1 188356846 missense probably benign 0.01
R6321:Ush2a UTSW 1 188849046 nonsense probably null
R6347:Ush2a UTSW 1 188910887 missense probably benign
R6382:Ush2a UTSW 1 188814302 missense probably benign 0.01
R6408:Ush2a UTSW 1 188267032 nonsense probably null
R6418:Ush2a UTSW 1 188628566 missense probably damaging 1.00
R6500:Ush2a UTSW 1 188841527 missense probably benign 0.00
R6504:Ush2a UTSW 1 188911247 missense probably benign 0.00
R6534:Ush2a UTSW 1 188451802 nonsense probably null
R6594:Ush2a UTSW 1 188910798 missense possibly damaging 0.93
R6612:Ush2a UTSW 1 188911397 missense possibly damaging 0.91
R6645:Ush2a UTSW 1 188523331 missense probably damaging 0.99
R6658:Ush2a UTSW 1 188814359 missense possibly damaging 0.95
R6726:Ush2a UTSW 1 188753684 missense possibly damaging 0.85
R6755:Ush2a UTSW 1 188443219 missense possibly damaging 0.95
R6782:Ush2a UTSW 1 188356834 missense probably benign
R6817:Ush2a UTSW 1 188862864 missense probably benign 0.03
R6834:Ush2a UTSW 1 188356792 missense probably damaging 1.00
R6851:Ush2a UTSW 1 188533205 missense probably benign 0.06
R6853:Ush2a UTSW 1 188911237 nonsense probably null
R6867:Ush2a UTSW 1 188910973 missense probably damaging 1.00
R6889:Ush2a UTSW 1 188797871 missense probably damaging 1.00
R6931:Ush2a UTSW 1 188728383 missense probably benign 0.01
R6953:Ush2a UTSW 1 188263145 missense possibly damaging 0.94
R6966:Ush2a UTSW 1 188576244 missense probably damaging 1.00
R7109:Ush2a UTSW 1 188381484 missense probably benign 0.19
R7153:Ush2a UTSW 1 188728484 missense possibly damaging 0.93
U24488:Ush2a UTSW 1 188430766 missense probably damaging 0.99
X0011:Ush2a UTSW 1 188318969 missense probably benign 0.00
X0024:Ush2a UTSW 1 188400282 missense probably damaging 1.00
X0026:Ush2a UTSW 1 188319025 missense possibly damaging 0.94
X0062:Ush2a UTSW 1 188549854 missense probably damaging 1.00
Y4340:Ush2a UTSW 1 188743629 missense possibly damaging 0.87
Y4341:Ush2a UTSW 1 188743629 missense possibly damaging 0.87
Z1088:Ush2a UTSW 1 188911983 missense probably benign
Z1088:Ush2a UTSW 1 188947004 missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- GGGACTACAGCTTTAGCCCATG -3'
(R):5'- GGCACTCAGATTCAAACTCATGG -3'

Sequencing Primer
(F):5'- TTGGGTCTGAAAAGTTTCACTTAG -3'
(R):5'- TCATGGTCTATGGGATCCAGAAAC -3'
Posted On2014-08-25