Incidental Mutation 'R0144:Fbxo30'
ID22513
Institutional Source Beutler Lab
Gene Symbol Fbxo30
Ensembl Gene ENSMUSG00000047648
Gene NameF-box protein 30
SynonymsFbx30
MMRRC Submission 038429-MU
Accession Numbers

Ncbi RefSeq: NM_027968.3, NM_001168297.1; MGI: 1919115

Is this an essential gene? Probably non essential (E-score: 0.172) question?
Stock #R0144 (G1)
Quality Score225
Status Validated (trace)
Chromosome10
Chromosomal Location11281330-11298052 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 11295220 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 681 (W681R)
Ref Sequence ENSEMBL: ENSMUSP00000117687 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070300] [ENSMUST00000129456]
Predicted Effect probably damaging
Transcript: ENSMUST00000070300
AA Change: W681R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000068230
Gene: ENSMUSG00000047648
AA Change: W681R

DomainStartEndE-ValueType
Pfam:zf-TRAF_2 8 100 2.5e-42 PFAM
Pfam:F-box_4 610 725 1.6e-52 PFAM
Pfam:F-box 612 653 3e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000129456
AA Change: W681R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000117687
Gene: ENSMUSG00000047648
AA Change: W681R

DomainStartEndE-ValueType
PDB:2YRE|A 1 88 6e-51 PDB
SCOP:d1k2fa_ 58 93 7e-3 SMART
Pfam:F-box 612 653 2.3e-7 PFAM
Meta Mutation Damage Score 0.38 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.0%
  • 20x: 87.0%
Validation Efficiency 100% (90/90)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of the ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbxs class and it is upregulated in nasopharyngeal carcinoma. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(32) : Targeted(2) Gene trapped(30)

Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcd4 T A 12: 84,605,965 probably null Het
Acp6 T A 3: 97,165,829 probably benign Het
AI661453 A T 17: 47,469,299 probably benign Het
Aox1 A G 1: 58,070,074 I674V probably benign Het
Armc2 A T 10: 41,947,887 probably benign Het
Atp8b1 G C 18: 64,571,374 probably benign Het
Baz2b A T 2: 59,907,495 N1823K probably damaging Het
Bbx C T 16: 50,280,392 E47K probably benign Het
Brca1 A T 11: 101,526,121 S396T probably damaging Het
Btnl6 G T 17: 34,514,020 R290S probably benign Het
Casp8ap2 A G 4: 32,643,797 R957G possibly damaging Het
Ccdc13 A G 9: 121,827,351 L132P probably damaging Het
Ccdc187 A G 2: 26,276,203 I738T probably damaging Het
Ccdc58 A T 16: 36,085,114 N92I possibly damaging Het
Ceacam15 G T 7: 16,673,191 H134N probably benign Het
Cep170 T C 1: 176,792,595 I46V probably benign Het
Cfap57 T C 4: 118,584,705 D722G probably damaging Het
Col11a1 A T 3: 114,113,594 D628V unknown Het
Csmd1 A T 8: 16,391,824 V342E probably benign Het
Dennd1a A G 2: 38,126,640 V64A probably damaging Het
Dlec1 G T 9: 119,142,866 G1345V probably benign Het
Dnah1 G A 14: 31,267,874 probably benign Het
Dock5 C T 14: 67,786,286 G1142D probably benign Het
Etv2 C A 7: 30,634,883 A142S probably benign Het
Fam110c C A 12: 31,074,501 T154K unknown Het
Fbxo17 C G 7: 28,735,340 D183E probably damaging Het
Fig4 A G 10: 41,258,049 Y413H probably damaging Het
Gab1 A G 8: 80,785,201 probably benign Het
Gabarapl1 T C 6: 129,533,448 M1T probably null Het
Gm4763 A G 7: 24,723,590 V101A possibly damaging Het
H2-M10.6 G A 17: 36,812,241 C22Y probably damaging Het
Igfn1 T C 1: 135,962,013 D2432G probably damaging Het
Il13 T C 11: 53,633,176 D60G possibly damaging Het
Iqgap1 A G 7: 80,751,920 L479P probably damaging Het
Itpr2 T A 6: 146,327,155 Q1314L probably damaging Het
Jrk C T 15: 74,706,156 G427S probably benign Het
Kcnb1 T G 2: 167,104,547 N794H probably damaging Het
Klhl8 A T 5: 103,867,938 S361R probably benign Het
Krt87 T C 15: 101,438,661 Y37C probably benign Het
Lbp A T 2: 158,319,710 S231C probably damaging Het
Lpin2 A G 17: 71,225,076 E142G probably damaging Het
Lrch4 G A 5: 137,638,543 probably null Het
Manea A G 4: 26,340,719 M81T probably benign Het
Mcm3ap A G 10: 76,481,015 T618A probably benign Het
Me3 A G 7: 89,739,872 D128G probably damaging Het
Mug2 A G 6: 122,071,011 probably benign Het
Myo9b A T 8: 71,346,043 Q901L probably damaging Het
Nalcn C T 14: 123,409,839 probably benign Het
Nalcn T C 14: 123,371,536 R640G probably damaging Het
Ncor1 T C 11: 62,392,595 N422S probably damaging Het
Nf1 T A 11: 79,547,127 Y88N probably damaging Het
Nrxn3 G A 12: 89,348,392 A358T probably damaging Het
Olfr1458 G A 19: 13,103,278 R3C possibly damaging Het
Olfr486 T C 7: 108,171,971 I258V probably benign Het
Olfr593 A T 7: 103,212,540 I216F probably damaging Het
Phlpp2 C T 8: 109,907,513 R242W probably damaging Het
Pld5 T C 1: 175,970,541 N431D probably benign Het
Prss28 G A 17: 25,309,450 V16M probably damaging Het
Psmd2 T A 16: 20,662,225 probably null Het
Ptpn21 A T 12: 98,688,609 S700T probably benign Het
Rasa2 A T 9: 96,592,019 V152D probably damaging Het
Reln G T 5: 21,948,449 R2286S probably damaging Het
Rflnb G T 11: 76,024,963 P102Q probably damaging Het
Rin2 G A 2: 145,876,639 V680I probably damaging Het
Rnf213 A T 11: 119,479,600 K4742* probably null Het
Rpp40 A T 13: 35,901,369 S143T probably benign Het
Rps12 A G 10: 23,786,791 I51T probably benign Het
Rsf1 T A 7: 97,636,407 W109R probably damaging Het
Sipa1l2 C T 8: 125,449,876 probably null Het
Tspan5 G T 3: 138,898,348 V165L probably damaging Het
Uts2r T A 11: 121,161,465 V385E probably benign Het
Vma21-ps T A 4: 52,497,231 D5V possibly damaging Het
Vmn2r62 T A 7: 42,789,016 N132I probably damaging Het
Zfp622 T C 15: 25,991,579 probably benign Het
Zmiz1 A G 14: 25,655,247 K766R probably damaging Het
Other mutations in Fbxo30
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00914:Fbxo30 APN 10 11290539 missense probably benign 0.01
IGL00971:Fbxo30 APN 10 11290298 missense probably benign
IGL02388:Fbxo30 APN 10 11290378 missense probably benign 0.01
PIT4468001:Fbxo30 UTSW 10 11290956 missense possibly damaging 0.95
R0014:Fbxo30 UTSW 10 11289859 nonsense probably null
R0709:Fbxo30 UTSW 10 11291313 missense possibly damaging 0.79
R1583:Fbxo30 UTSW 10 11291374 missense possibly damaging 0.67
R1791:Fbxo30 UTSW 10 11289787 nonsense probably null
R2018:Fbxo30 UTSW 10 11291028 missense probably damaging 0.98
R2317:Fbxo30 UTSW 10 11290334 missense probably damaging 0.98
R3842:Fbxo30 UTSW 10 11290112 missense probably damaging 0.98
R4579:Fbxo30 UTSW 10 11289549 missense probably benign 0.00
R4655:Fbxo30 UTSW 10 11291093 missense probably damaging 1.00
R4751:Fbxo30 UTSW 10 11290195 missense probably benign 0.01
R4998:Fbxo30 UTSW 10 11290763 missense probably damaging 0.98
R5325:Fbxo30 UTSW 10 11291102 missense possibly damaging 0.89
R5463:Fbxo30 UTSW 10 11291069 missense probably damaging 1.00
R5534:Fbxo30 UTSW 10 11289665 missense possibly damaging 0.91
R5594:Fbxo30 UTSW 10 11290479 missense probably benign 0.13
R5757:Fbxo30 UTSW 10 11290421 missense probably benign 0.08
R5917:Fbxo30 UTSW 10 11289518 critical splice acceptor site probably null
R6232:Fbxo30 UTSW 10 11289858 missense possibly damaging 0.90
R6472:Fbxo30 UTSW 10 11291231 missense probably damaging 1.00
R6677:Fbxo30 UTSW 10 11290636 missense possibly damaging 0.61
R6802:Fbxo30 UTSW 10 11291480 missense probably damaging 1.00
R7128:Fbxo30 UTSW 10 11290116 nonsense probably null
X0012:Fbxo30 UTSW 10 11290466 missense probably benign 0.00
X0066:Fbxo30 UTSW 10 11290812 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGGTCATCACCATCTCTAGCTGATAG -3'
(R):5'- GCTTTAAAACTGAGCGCAGGGAAC -3'

Sequencing Primer
(F):5'- CTCTAGCTGATAGAGAGTTATGGAC -3'
(R):5'- GGAACGTCCTTCTTTTGTAAGC -3'
Posted On2013-04-16