Incidental Mutation 'R2043:Eif5b'
ID 225155
Institutional Source Beutler Lab
Gene Symbol Eif5b
Ensembl Gene ENSMUSG00000026083
Gene Name eukaryotic translation initiation factor 5B
Synonyms IF2, A030003E17Rik
MMRRC Submission 040050-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R2043 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 38037091-38094660 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 38080900 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Serine at position 747 (F747S)
Ref Sequence ENSEMBL: ENSMUSP00000027252 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027252]
AlphaFold Q05D44
Predicted Effect probably damaging
Transcript: ENSMUST00000027252
AA Change: F747S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027252
Gene: ENSMUSG00000026083
AA Change: F747S

DomainStartEndE-ValueType
low complexity region 19 32 N/A INTRINSIC
low complexity region 33 51 N/A INTRINSIC
low complexity region 94 106 N/A INTRINSIC
low complexity region 110 126 N/A INTRINSIC
low complexity region 145 161 N/A INTRINSIC
low complexity region 183 193 N/A INTRINSIC
coiled coil region 227 272 N/A INTRINSIC
coiled coil region 301 414 N/A INTRINSIC
low complexity region 480 498 N/A INTRINSIC
coiled coil region 523 554 N/A INTRINSIC
low complexity region 580 594 N/A INTRINSIC
Pfam:GTP_EFTU 625 840 4.7e-35 PFAM
Pfam:MMR_HSR1 629 753 5.1e-6 PFAM
Pfam:GTP_EFTU_D2 866 944 7.1e-11 PFAM
Pfam:IF-2 959 1066 1.4e-20 PFAM
Blast:S1 1116 1172 2e-6 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192548
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193151
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193806
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195664
Meta Mutation Damage Score 0.9202 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 96% (47/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Accurate initiation of translation in eukaryotes is complex and requires many factors, some of which are composed of multiple subunits. The process is simpler in prokaryotes which have only three initiation factors (IF1, IF2, IF3). Two of these factors are conserved in eukaryotes: the homolog of IF1 is eIF1A and the homolog of IF2 is eIF5B. This gene encodes eIF5B. Factors eIF1A and eIF5B interact on the ribosome along with other initiation factors and GTP to position the initiation methionine tRNA on the start codon of the mRNA so that translation initiates accurately. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam9 A G 8: 25,486,669 (GRCm39) probably null Het
Adnp2 A C 18: 80,171,541 (GRCm39) M956R probably damaging Het
Aldh1l1 T A 6: 90,534,314 (GRCm39) D36E probably benign Het
Ankmy1 T C 1: 92,804,249 (GRCm39) probably benign Het
Apaf1 T C 10: 90,872,890 (GRCm39) D718G probably damaging Het
Ascc3 C T 10: 50,576,616 (GRCm39) P857L probably damaging Het
Atp8b1 T C 18: 64,738,271 (GRCm39) K60R possibly damaging Het
Bub1 A T 2: 127,646,140 (GRCm39) C947S probably damaging Het
Cacna1c C T 6: 118,573,049 (GRCm39) G2017D probably benign Het
Capn3 A G 2: 120,322,382 (GRCm39) N414S possibly damaging Het
Ccdc110 T C 8: 46,395,864 (GRCm39) M585T probably benign Het
Cep85l A T 10: 53,234,224 (GRCm39) N51K possibly damaging Het
Cftr T C 6: 18,320,934 (GRCm39) F1415L probably benign Het
Cln5 T C 14: 103,313,380 (GRCm39) S211P probably damaging Het
Dcaf5 A T 12: 80,386,991 (GRCm39) D378E probably benign Het
Dhx57 A G 17: 80,560,509 (GRCm39) probably benign Het
Dsn1 G A 2: 156,847,273 (GRCm39) S55L possibly damaging Het
Entrep3 A G 3: 89,092,874 (GRCm39) Y251C probably damaging Het
Fbxo25 A G 8: 13,971,905 (GRCm39) I86V probably damaging Het
Fpr-rs4 CAGGAA CA 17: 18,242,596 (GRCm39) probably null Het
Glcci1 T A 6: 8,582,590 (GRCm39) I130K probably damaging Het
Gm5424 A G 10: 61,906,990 (GRCm39) noncoding transcript Het
Gsdma G A 11: 98,557,046 (GRCm39) V54M possibly damaging Het
H3c3 A G 13: 23,929,278 (GRCm39) F68S probably damaging Het
Heatr3 T A 8: 88,874,322 (GRCm39) probably benign Het
Hspa13 A G 16: 75,555,156 (GRCm39) L310S probably benign Het
Il6st A C 13: 112,616,753 (GRCm39) Q100P probably benign Het
Ly6g6e G A 17: 35,296,840 (GRCm39) R27Q possibly damaging Het
Mis18bp1 A T 12: 65,196,192 (GRCm39) I524K probably damaging Het
Myo18a T C 11: 77,714,189 (GRCm39) I761T probably damaging Het
Mypop T C 7: 18,734,944 (GRCm39) probably benign Het
Or51ag1 A G 7: 103,156,150 (GRCm39) M1T probably null Het
Pcdh20 G A 14: 88,704,591 (GRCm39) T903I probably benign Het
Pdk4 A T 6: 5,485,502 (GRCm39) C396S probably benign Het
Piwil2 A G 14: 70,628,919 (GRCm39) V699A probably benign Het
Plekha5 T C 6: 140,498,530 (GRCm39) probably benign Het
Ralgapa1 T A 12: 55,723,811 (GRCm39) I1572L probably damaging Het
Rasgrf2 T A 13: 92,167,351 (GRCm39) M241L possibly damaging Het
Ryr1 C T 7: 28,759,056 (GRCm39) R3374H probably damaging Het
Slc24a2 A T 4: 86,914,882 (GRCm39) M519K probably damaging Het
Smg9 T A 7: 24,105,001 (GRCm39) I67N possibly damaging Het
Spart G A 3: 55,034,969 (GRCm39) A452T probably damaging Het
Ush2a T A 1: 188,648,453 (GRCm39) F4686Y probably benign Het
Zfp146 T C 7: 29,861,664 (GRCm39) K126R possibly damaging Het
Zfp386 T A 12: 116,022,781 (GRCm39) D131E probably benign Het
Zfp423 T C 8: 88,509,246 (GRCm39) D366G probably damaging Het
Zfp729a T C 13: 67,769,291 (GRCm39) K313E probably damaging Het
Zfp955a G A 17: 33,461,527 (GRCm39) H202Y possibly damaging Het
Other mutations in Eif5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Eif5b APN 1 38,080,800 (GRCm39) missense probably damaging 1.00
IGL01377:Eif5b APN 1 38,075,179 (GRCm39) missense probably benign
IGL01395:Eif5b APN 1 38,076,339 (GRCm39) missense probably damaging 0.96
IGL01572:Eif5b APN 1 38,061,335 (GRCm39) nonsense probably null
IGL01615:Eif5b APN 1 38,084,787 (GRCm39) missense probably damaging 1.00
IGL02141:Eif5b APN 1 38,071,403 (GRCm39) missense probably benign 0.09
IGL02260:Eif5b APN 1 38,084,537 (GRCm39) missense possibly damaging 0.81
IGL02308:Eif5b APN 1 38,080,828 (GRCm39) missense probably damaging 1.00
IGL03180:Eif5b APN 1 38,075,350 (GRCm39) missense probably damaging 1.00
IGL03327:Eif5b APN 1 38,080,772 (GRCm39) splice site probably benign
R0018:Eif5b UTSW 1 38,057,970 (GRCm39) missense unknown
R0036:Eif5b UTSW 1 38,058,192 (GRCm39) missense probably benign 0.23
R0137:Eif5b UTSW 1 38,058,324 (GRCm39) missense probably benign 0.23
R0349:Eif5b UTSW 1 38,071,447 (GRCm39) missense probably benign 0.18
R0606:Eif5b UTSW 1 38,087,974 (GRCm39) missense probably damaging 1.00
R1056:Eif5b UTSW 1 38,061,248 (GRCm39) missense unknown
R1225:Eif5b UTSW 1 38,076,709 (GRCm39) missense probably damaging 1.00
R2163:Eif5b UTSW 1 38,087,875 (GRCm39) missense probably benign 0.32
R2225:Eif5b UTSW 1 38,058,304 (GRCm39) missense unknown
R2432:Eif5b UTSW 1 38,058,423 (GRCm39) missense unknown
R2922:Eif5b UTSW 1 38,057,100 (GRCm39) splice site probably benign
R4357:Eif5b UTSW 1 38,089,339 (GRCm39) missense probably damaging 1.00
R4631:Eif5b UTSW 1 38,080,828 (GRCm39) missense probably damaging 1.00
R4665:Eif5b UTSW 1 38,084,793 (GRCm39) missense probably damaging 1.00
R4702:Eif5b UTSW 1 38,057,958 (GRCm39) missense unknown
R4941:Eif5b UTSW 1 38,090,280 (GRCm39) missense probably damaging 1.00
R4995:Eif5b UTSW 1 38,090,792 (GRCm39) makesense probably null
R5020:Eif5b UTSW 1 38,058,150 (GRCm39) nonsense probably null
R5175:Eif5b UTSW 1 38,084,468 (GRCm39) missense probably damaging 1.00
R5375:Eif5b UTSW 1 38,084,835 (GRCm39) missense possibly damaging 0.66
R5566:Eif5b UTSW 1 38,084,765 (GRCm39) missense possibly damaging 0.90
R5566:Eif5b UTSW 1 38,090,328 (GRCm39) missense probably damaging 1.00
R5853:Eif5b UTSW 1 38,076,388 (GRCm39) missense probably damaging 1.00
R5978:Eif5b UTSW 1 38,037,361 (GRCm39) splice site probably null
R6315:Eif5b UTSW 1 38,057,114 (GRCm39) missense unknown
R6376:Eif5b UTSW 1 38,084,760 (GRCm39) missense probably damaging 0.98
R6388:Eif5b UTSW 1 38,058,081 (GRCm39) missense unknown
R6444:Eif5b UTSW 1 38,075,292 (GRCm39) missense probably damaging 1.00
R6455:Eif5b UTSW 1 38,058,108 (GRCm39) missense probably benign 0.23
R6810:Eif5b UTSW 1 38,085,741 (GRCm39) missense probably benign 0.45
R6877:Eif5b UTSW 1 38,089,320 (GRCm39) missense probably damaging 1.00
R7130:Eif5b UTSW 1 38,080,857 (GRCm39) missense probably damaging 1.00
R7180:Eif5b UTSW 1 38,088,155 (GRCm39) missense probably damaging 0.98
R7439:Eif5b UTSW 1 38,090,718 (GRCm39) missense probably benign 0.28
R7488:Eif5b UTSW 1 38,089,387 (GRCm39) missense possibly damaging 0.69
R8140:Eif5b UTSW 1 38,090,357 (GRCm39) missense probably benign 0.41
R8166:Eif5b UTSW 1 38,087,901 (GRCm39) missense probably benign 0.11
R8191:Eif5b UTSW 1 38,075,283 (GRCm39) missense probably damaging 0.98
R8304:Eif5b UTSW 1 38,084,774 (GRCm39) missense probably benign 0.11
R8549:Eif5b UTSW 1 38,076,288 (GRCm39) missense possibly damaging 0.96
R8558:Eif5b UTSW 1 38,083,795 (GRCm39) missense probably damaging 0.99
R8893:Eif5b UTSW 1 38,090,300 (GRCm39) missense possibly damaging 0.48
R9452:Eif5b UTSW 1 38,084,861 (GRCm39) missense probably damaging 1.00
R9487:Eif5b UTSW 1 38,084,560 (GRCm39) missense probably damaging 0.99
R9487:Eif5b UTSW 1 38,058,451 (GRCm39) nonsense probably null
R9542:Eif5b UTSW 1 38,057,131 (GRCm39) nonsense probably null
R9721:Eif5b UTSW 1 38,076,740 (GRCm39) critical splice donor site probably null
R9745:Eif5b UTSW 1 38,084,729 (GRCm39) missense probably damaging 1.00
R9748:Eif5b UTSW 1 38,090,241 (GRCm39) missense possibly damaging 0.89
RF018:Eif5b UTSW 1 38,060,673 (GRCm39) critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- CCAGAGAGACTGTACGTGTTTTC -3'
(R):5'- TCATACTGCCTGGCAAGAGG -3'

Sequencing Primer
(F):5'- TTCTGTCTCTTTAGGCTTTACAAAG -3'
(R):5'- CAAGAGGAGCCAAGTTCTGTCC -3'
Posted On 2014-08-25