Incidental Mutation 'R1991:Kalrn'
ID225257
Institutional Source Beutler Lab
Gene Symbol Kalrn
Ensembl Gene ENSMUSG00000061751
Gene Namekalirin, RhoGEF kinase
Synonyms2210407G14Rik, Hapip, E530005C20Rik, LOC224126
MMRRC Submission 040002-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.868) question?
Stock #R1991 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location33969073-34573532 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 33975738 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 1222 (L1222F)
Ref Sequence ENSEMBL: ENSMUSP00000110624 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076810] [ENSMUST00000114973]
Predicted Effect probably damaging
Transcript: ENSMUST00000076810
AA Change: L2891F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000076088
Gene: ENSMUSG00000061751
AA Change: L2891F

DomainStartEndE-ValueType
SEC14 20 159 2.22e-30 SMART
SPEC 173 289 5.32e-9 SMART
SPEC 295 397 1.19e-11 SMART
SPEC 400 515 1.83e0 SMART
SPEC 521 623 9.84e-13 SMART
SPEC 626 748 2.74e-2 SMART
SPEC 875 976 8.11e-14 SMART
SPEC 1106 1208 4.7e-10 SMART
RhoGEF 1258 1428 3.6e-56 SMART
PH 1442 1555 5.24e-8 SMART
SH3 1622 1683 1.23e-7 SMART
RhoGEF 1904 2074 1.47e-52 SMART
PH 2094 2199 9.87e-4 SMART
SH3 2295 2356 2.78e-2 SMART
IGc2 2455 2527 4.28e-12 SMART
FN3 2541 2623 3.07e-11 SMART
S_TKc 2656 2910 1.28e-71 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000114973
AA Change: L1222F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110624
Gene: ENSMUSG00000061751
AA Change: L1222F

DomainStartEndE-ValueType
RhoGEF 235 405 1.47e-52 SMART
PH 425 530 9.87e-4 SMART
SH3 626 687 2.78e-2 SMART
IGc2 786 858 4.28e-12 SMART
FN3 872 954 3.07e-11 SMART
S_TKc 987 1241 1.28e-71 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132002
Meta Mutation Damage Score 0.204 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.3%
Validation Efficiency 100% (124/124)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Huntington's disease (HD), a neurodegenerative disorder characterized by loss of striatal neurons, is caused by an expansion of a polyglutamine tract in the HD protein huntingtin. This gene encodes a protein that interacts with the huntingtin-associated protein 1, which is a huntingtin binding protein that may function in vesicle trafficking. [provided by RefSeq, Apr 2016]
PHENOTYPE: Mice homozygous for a knock-out allele specific for isoform 7 exhibit decreased anxiety-related behavior, contextual conditioning, and synapse formation. Mice homozygous for another knock-out allele exhibit impaired AMPA-mediated synaptic currents and abnormal behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 123 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik C T 3: 138,065,658 R203* probably null Het
Abcc2 A T 19: 43,807,142 I446F probably damaging Het
Afap1l2 A T 19: 57,002,267 I18N possibly damaging Het
Aida A T 1: 183,313,692 E107D probably benign Het
Amer2 A G 14: 60,379,820 Y362C probably damaging Het
Amigo1 T C 3: 108,187,328 S48P probably benign Het
Ano5 A G 7: 51,537,813 K50R possibly damaging Het
Anxa2 A T 9: 69,483,816 D95V probably damaging Het
Arhgap22 A G 14: 33,366,959 N466D probably damaging Het
Armc3 T C 2: 19,293,142 Y575H probably damaging Het
Ascc2 A G 11: 4,679,257 E523G probably benign Het
B3galt5 A T 16: 96,316,025 K286M probably damaging Het
Bag3 C T 7: 128,545,683 H341Y probably benign Het
Blm G T 7: 80,505,949 probably null Het
Cacna1b G A 2: 24,732,306 P222L probably damaging Het
Cap2 T A 13: 46,637,881 Y175N possibly damaging Het
Cd81 G T 7: 143,067,201 G206* probably null Het
Cep290 T A 10: 100,531,184 S1132R possibly damaging Het
Cluh C A 11: 74,659,529 C222* probably null Het
Col14a1 A T 15: 55,449,940 D1320V unknown Het
Col18a1 T C 10: 77,081,154 I114V unknown Het
Cped1 A G 6: 22,233,927 T847A probably damaging Het
Cpne7 A G 8: 123,127,437 K288E possibly damaging Het
Cr2 G A 1: 195,154,150 P1278S possibly damaging Het
Creb3 C A 4: 43,565,327 R202S probably damaging Het
Cyp2j9 T A 4: 96,571,964 K434M probably damaging Het
Dpp10 A T 1: 123,905,106 V48E probably null Het
Dsg2 A G 18: 20,601,473 K836R probably damaging Het
Dst A G 1: 34,190,258 T1986A probably benign Het
Dvl1 G A 4: 155,847,816 V28I possibly damaging Het
Ecm2 A G 13: 49,530,256 D570G probably benign Het
Efhc1 T A 1: 20,989,560 C611* probably null Het
Epop T C 11: 97,628,654 T210A probably benign Het
Erc2 A G 14: 28,011,636 I556V probably benign Het
Fdxacb1 A T 9: 50,771,646 N101I probably benign Het
Fhad1 T C 4: 141,982,162 S294G possibly damaging Het
Galnt16 A G 12: 80,583,656 D262G probably damaging Het
Gm9573 A T 17: 35,618,708 S1529T probably benign Het
Gorab A G 1: 163,397,056 S59P probably damaging Het
Gpr161 G T 1: 165,306,563 M131I probably damaging Het
Gpr22 T A 12: 31,709,203 M270L probably benign Het
Grin3b C A 10: 79,970,912 Q5K probably benign Het
Grin3b C T 10: 79,974,646 A662V probably damaging Het
Gsdmc A G 15: 63,801,899 I179T probably benign Het
Gsdmc2 T A 15: 63,828,237 M229L probably benign Het
H2-Eb2 A G 17: 34,334,304 I155V probably benign Het
Hoga1 A C 19: 42,060,020 probably null Het
Hs3st5 A G 10: 36,832,886 Y139C probably damaging Het
Il10ra C A 9: 45,255,811 A481S probably benign Het
Ints2 T A 11: 86,248,934 H278L possibly damaging Het
Klhl25 T A 7: 75,866,732 V157D probably damaging Het
Klk1b26 A T 7: 44,016,900 T256S probably damaging Het
Krt81 T C 15: 101,462,554 Q184R probably benign Het
Lce1k A T 3: 92,806,818 C20S unknown Het
Letm1 A AG 5: 33,769,515 probably null Het
Lin54 A G 5: 100,485,801 probably null Het
Lrrc37a T C 11: 103,500,261 E1446G probably benign Het
Macf1 A G 4: 123,456,695 S3792P probably damaging Het
Manba T A 3: 135,551,191 D538E probably benign Het
Mcc C A 18: 44,491,315 E213* probably null Het
Mfap4 T C 11: 61,485,807 probably null Het
Nebl T A 2: 17,452,510 I80F probably damaging Het
Nek4 A G 14: 30,956,953 I145V probably damaging Het
Nlrp14 T C 7: 107,196,200 V230A probably benign Het
Nxf3 G A X: 136,075,834 P380S possibly damaging Het
Olfr1451 T C 19: 12,999,502 V172A possibly damaging Het
Olfr403 T C 11: 74,196,163 V220A probably damaging Het
Olfr421-ps1 C T 1: 174,152,121 H202Y probably damaging Het
Olfr490 C A 7: 108,286,359 G256* probably null Het
Olfr745 G A 14: 50,642,866 C195Y possibly damaging Het
Pcdhb13 C T 18: 37,443,859 T430I possibly damaging Het
Piezo2 A T 18: 63,074,662 L1426Q probably null Het
Pigk T A 3: 152,744,494 Y212N probably damaging Het
Pigm T G 1: 172,377,261 L188R probably damaging Het
Plce1 T C 19: 38,777,924 F2117S probably damaging Het
Plec A G 15: 76,173,543 F4055L probably damaging Het
Plk5 C T 10: 80,363,102 S435L possibly damaging Het
Pms1 G A 1: 53,282,042 L11F probably damaging Het
Prl3b1 C T 13: 27,247,912 T140I possibly damaging Het
Prl7a1 T G 13: 27,633,672 D203A probably damaging Het
Psg17 A G 7: 18,814,652 V398A probably benign Het
Pum1 T A 4: 130,718,218 I166K possibly damaging Het
R3hdm1 T A 1: 128,169,016 D108E probably damaging Het
Reln A T 5: 21,969,360 D1948E possibly damaging Het
Rnf112 C T 11: 61,452,426 R141Q probably damaging Het
Rnf145 T C 11: 44,561,466 V424A possibly damaging Het
Serpina3m C A 12: 104,389,699 Y208* probably null Het
Serpind1 T C 16: 17,342,944 V446A probably benign Het
Shc3 T A 13: 51,442,836 M384L probably benign Het
Slc38a11 A G 2: 65,330,339 F304L probably benign Het
Slpi C T 2: 164,355,543 C28Y probably damaging Het
Specc1 C A 11: 62,029,294 P7T possibly damaging Het
Spib T C 7: 44,528,857 E180G probably benign Het
Spint5 T C 2: 164,716,983 probably benign Het
Ssr2 T A 3: 88,576,867 probably benign Het
Tbrg1 T C 9: 37,649,419 D387G probably benign Het
Tex14 T G 11: 87,549,470 L1367R probably damaging Het
Tfpi A C 2: 84,458,016 probably benign Het
Tlr5 T A 1: 182,974,347 D405E probably damaging Het
Tnnt3 C T 7: 142,511,525 R131C possibly damaging Het
Tnxb T C 17: 34,671,904 V407A probably damaging Het
Tnxb A G 17: 34,682,251 Y1013C probably damaging Het
Tpx2 T A 2: 152,890,624 M606K probably benign Het
Trim30a T A 7: 104,430,230 probably benign Het
Trim46 A T 3: 89,237,701 Y489N probably damaging Het
Trpm6 A T 19: 18,796,284 H380L probably benign Het
Tstd2 A G 4: 46,120,563 I279T probably benign Het
Ttn C T 2: 76,946,391 probably null Het
Txnl1 T C 18: 63,679,514 T70A probably benign Het
Ush2a C T 1: 188,578,532 probably benign Het
Usp1 A G 4: 98,934,294 D615G probably benign Het
Virma T A 4: 11,519,242 C830S probably benign Het
Vmn1r7 A T 6: 57,024,868 S136T probably benign Het
Vmn2r9 A G 5: 108,846,439 V448A probably damaging Het
Vps11 G A 9: 44,359,227 H183Y probably damaging Het
Vsig10l A G 7: 43,467,468 T476A possibly damaging Het
Wdr63 G T 3: 146,063,480 T522K possibly damaging Het
Whamm C T 7: 81,591,771 R277* probably null Het
Wnt8a A G 18: 34,544,884 D115G probably damaging Het
Xndc1 T A 7: 102,073,191 V21E probably damaging Het
Zc3hav1 C A 6: 38,336,517 V198L probably damaging Het
Zfp874a T A 13: 67,442,504 I354F probably benign Het
Zfr2 A T 10: 81,242,852 D306V possibly damaging Het
Other mutations in Kalrn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01361:Kalrn APN 16 34175722 splice site probably benign
IGL01364:Kalrn APN 16 34262629 missense probably damaging 1.00
IGL01510:Kalrn APN 16 34235330 missense possibly damaging 0.52
IGL01664:Kalrn APN 16 34294161 missense probably damaging 1.00
IGL01934:Kalrn APN 16 34198512 splice site probably null
IGL02059:Kalrn APN 16 34252341 missense possibly damaging 0.95
IGL02102:Kalrn APN 16 34220222 missense probably damaging 1.00
IGL02306:Kalrn APN 16 34310527 missense probably damaging 0.97
IGL02328:Kalrn APN 16 34332224 missense probably damaging 0.98
IGL02532:Kalrn APN 16 34360846 missense probably damaging 1.00
IGL02685:Kalrn APN 16 34513959 nonsense probably null
IGL02696:Kalrn APN 16 34220114 missense probably damaging 1.00
IGL02708:Kalrn APN 16 34392050 missense probably damaging 1.00
IGL02937:Kalrn APN 16 34220130 nonsense probably null
IGL03188:Kalrn APN 16 34314192 missense probably benign 0.01
IGL03289:Kalrn APN 16 34385297 missense possibly damaging 0.90
IGL03408:Kalrn APN 16 34314176 missense probably damaging 0.99
R6808_Kalrn_672 UTSW 16 34027976 missense probably damaging 1.00
PIT4498001:Kalrn UTSW 16 34031582 missense possibly damaging 0.81
R0019:Kalrn UTSW 16 34198514 splice site probably benign
R0043:Kalrn UTSW 16 34054906 missense probably damaging 1.00
R0052:Kalrn UTSW 16 34357171 missense probably damaging 1.00
R0066:Kalrn UTSW 16 34203957 missense probably damaging 1.00
R0098:Kalrn UTSW 16 33975619 missense possibly damaging 0.89
R0098:Kalrn UTSW 16 33975619 missense possibly damaging 0.89
R0111:Kalrn UTSW 16 34031590 missense probably damaging 1.00
R0113:Kalrn UTSW 16 34049936 intron probably benign
R0183:Kalrn UTSW 16 34171379 splice site probably null
R0422:Kalrn UTSW 16 34314273 missense probably damaging 0.99
R0498:Kalrn UTSW 16 34054891 missense possibly damaging 0.61
R0614:Kalrn UTSW 16 33993670 splice site probably benign
R0656:Kalrn UTSW 16 34032467 missense probably damaging 1.00
R0671:Kalrn UTSW 16 34116408 missense probably benign 0.04
R0707:Kalrn UTSW 16 34010581 missense possibly damaging 0.88
R0709:Kalrn UTSW 16 34035554 missense probably damaging 1.00
R0834:Kalrn UTSW 16 34049919 missense possibly damaging 0.94
R0976:Kalrn UTSW 16 34385390 missense probably damaging 1.00
R1297:Kalrn UTSW 16 34016498 missense probably damaging 0.99
R1355:Kalrn UTSW 16 33975584 missense possibly damaging 0.74
R1370:Kalrn UTSW 16 33975584 missense possibly damaging 0.74
R1389:Kalrn UTSW 16 33988803 missense probably benign 0.01
R1398:Kalrn UTSW 16 34212820 missense probably damaging 1.00
R1427:Kalrn UTSW 16 33975754 missense probably damaging 1.00
R1458:Kalrn UTSW 16 34174487 missense probably damaging 1.00
R1470:Kalrn UTSW 16 34187471 missense probably damaging 1.00
R1470:Kalrn UTSW 16 34187471 missense probably damaging 1.00
R1557:Kalrn UTSW 16 34314278 missense possibly damaging 0.92
R1559:Kalrn UTSW 16 34010548 missense possibly damaging 0.92
R1654:Kalrn UTSW 16 33975738 missense probably damaging 1.00
R1703:Kalrn UTSW 16 34205326 missense probably damaging 1.00
R1759:Kalrn UTSW 16 34360950 missense probably damaging 0.97
R1764:Kalrn UTSW 16 34212873 missense probably damaging 1.00
R1824:Kalrn UTSW 16 34294215 missense probably damaging 1.00
R1845:Kalrn UTSW 16 34356961 missense probably damaging 0.99
R1850:Kalrn UTSW 16 33975923 missense probably damaging 0.98
R1921:Kalrn UTSW 16 34392093 missense probably benign 0.02
R1922:Kalrn UTSW 16 34392093 missense probably benign 0.02
R1970:Kalrn UTSW 16 33977524 critical splice donor site probably null
R1992:Kalrn UTSW 16 33975738 missense probably damaging 1.00
R2001:Kalrn UTSW 16 34028045 missense probably damaging 1.00
R2025:Kalrn UTSW 16 34189736 missense probably damaging 0.96
R2048:Kalrn UTSW 16 34252310 missense probably benign 0.18
R2076:Kalrn UTSW 16 34332143 missense probably benign 0.15
R2118:Kalrn UTSW 16 34332230 missense possibly damaging 0.84
R2136:Kalrn UTSW 16 34307724 missense possibly damaging 0.82
R2145:Kalrn UTSW 16 34009262 unclassified probably benign
R2193:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R2195:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R2234:Kalrn UTSW 16 34176262 splice site probably null
R2404:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R2405:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R2408:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R2411:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R2570:Kalrn UTSW 16 34310495 missense probably damaging 1.00
R2903:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R2904:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R2924:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R3411:Kalrn UTSW 16 34212272 missense probably benign 0.07
R3693:Kalrn UTSW 16 34357315 missense probably damaging 1.00
R3709:Kalrn UTSW 16 34392030 splice site probably null
R3788:Kalrn UTSW 16 34220240 missense probably damaging 1.00
R3833:Kalrn UTSW 16 34039889 nonsense probably null
R3871:Kalrn UTSW 16 34203856 splice site probably null
R3934:Kalrn UTSW 16 34310531 missense probably benign 0.34
R4033:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R4056:Kalrn UTSW 16 34314209 missense probably damaging 0.99
R4057:Kalrn UTSW 16 34314209 missense probably damaging 0.99
R4303:Kalrn UTSW 16 34235391 missense probably damaging 1.00
R4402:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R4444:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R4482:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R4487:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R4558:Kalrn UTSW 16 33987208 missense possibly damaging 0.46
R4572:Kalrn UTSW 16 34392042 missense probably damaging 0.98
R4583:Kalrn UTSW 16 34235267 missense probably damaging 1.00
R4604:Kalrn UTSW 16 34513926 missense possibly damaging 0.46
R4620:Kalrn UTSW 16 34028705 missense probably damaging 0.99
R4651:Kalrn UTSW 16 34176391 missense probably damaging 1.00
R4703:Kalrn UTSW 16 34203957 missense probably damaging 1.00
R4704:Kalrn UTSW 16 34203957 missense probably damaging 1.00
R4705:Kalrn UTSW 16 34203957 missense probably damaging 1.00
R4760:Kalrn UTSW 16 34198487 missense probably damaging 1.00
R4793:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R4794:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R4811:Kalrn UTSW 16 34356969 missense probably damaging 1.00
R4816:Kalrn UTSW 16 34514019 unclassified probably benign
R4888:Kalrn UTSW 16 34171330 missense probably damaging 1.00
R4952:Kalrn UTSW 16 34357415 intron probably null
R5030:Kalrn UTSW 16 33975742 missense probably benign 0.00
R5045:Kalrn UTSW 16 34314352 nonsense probably null
R5117:Kalrn UTSW 16 34033601 critical splice acceptor site probably null
R5289:Kalrn UTSW 16 34252341 missense possibly damaging 0.95
R5426:Kalrn UTSW 16 34262653 missense probably damaging 1.00
R5432:Kalrn UTSW 16 34053622 missense probably damaging 1.00
R5611:Kalrn UTSW 16 34175780 missense probably damaging 1.00
R5629:Kalrn UTSW 16 34039934 missense possibly damaging 0.77
R5635:Kalrn UTSW 16 34014084 missense probably damaging 1.00
R5713:Kalrn UTSW 16 34016579 missense probably benign
R5716:Kalrn UTSW 16 33987176 missense probably benign 0.01
R5772:Kalrn UTSW 16 33975820 missense probably damaging 1.00
R5797:Kalrn UTSW 16 34212249 missense probably damaging 0.98
R5835:Kalrn UTSW 16 33987091 missense probably benign 0.28
R5895:Kalrn UTSW 16 33975435 utr 3 prime probably benign
R5924:Kalrn UTSW 16 34243833 missense probably damaging 1.00
R5999:Kalrn UTSW 16 34357343 missense probably damaging 1.00
R6010:Kalrn UTSW 16 34010580 missense probably benign 0.06
R6052:Kalrn UTSW 16 34360885 missense probably damaging 1.00
R6122:Kalrn UTSW 16 33985191 missense possibly damaging 0.82
R6128:Kalrn UTSW 16 34212885 missense probably damaging 0.99
R6136:Kalrn UTSW 16 34357111 missense probably damaging 1.00
R6178:Kalrn UTSW 16 34053639 missense possibly damaging 0.88
R6229:Kalrn UTSW 16 34055071 missense probably damaging 1.00
R6376:Kalrn UTSW 16 33975991 missense probably benign
R6397:Kalrn UTSW 16 33992985 missense probably damaging 1.00
R6429:Kalrn UTSW 16 34332164 missense possibly damaging 0.85
R6473:Kalrn UTSW 16 34205302 missense probably damaging 1.00
R6481:Kalrn UTSW 16 34360984 missense probably damaging 1.00
R6597:Kalrn UTSW 16 34182747 missense probably damaging 1.00
R6736:Kalrn UTSW 16 34217923 missense probably damaging 1.00
R6808:Kalrn UTSW 16 34027976 missense probably damaging 1.00
R6897:Kalrn UTSW 16 33975703 missense probably damaging 0.99
R6955:Kalrn UTSW 16 34220136 missense probably damaging 1.00
R7060:Kalrn UTSW 16 34357048 missense probably damaging 0.99
R7064:Kalrn UTSW 16 34217891 missense probably damaging 1.00
R7132:Kalrn UTSW 16 34256227 missense unknown
R7154:Kalrn UTSW 16 34212157 critical splice donor site probably null
R7181:Kalrn UTSW 16 34163077 missense probably benign 0.00
R7234:Kalrn UTSW 16 34176422 missense possibly damaging 0.63
R7235:Kalrn UTSW 16 34175761 missense probably benign 0.18
Predicted Primers PCR Primer
(F):5'- TGGTTCACCCTATTGACGATGTAAC -3'
(R):5'- TGATCCAAGGCATCCCTGTC -3'

Sequencing Primer
(F):5'- ACGATGTAACTCTTGACATTGGG -3'
(R):5'- TGTCTCCCTGGGCACAG -3'
Posted On2014-08-25