Incidental Mutation 'R2038:Set'
ID225265
Institutional Source Beutler Lab
Gene Symbol Set
Ensembl Gene ENSMUSG00000054766
Gene NameSET nuclear oncogene
Synonyms2610030F17Rik, StF-IT-1, 5730420M11Rik
MMRRC Submission 040045-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.632) question?
Stock #R2038 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location30057378-30072577 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 30070200 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 182 (S182P)
Ref Sequence ENSEMBL: ENSMUSP00000099930 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067996] [ENSMUST00000102866] [ENSMUST00000134364] [ENSMUST00000149578]
Predicted Effect probably benign
Transcript: ENSMUST00000067996
AA Change: S170P

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000070002
Gene: ENSMUSG00000054766
AA Change: S170P

DomainStartEndE-ValueType
Pfam:NAP 29 224 6.4e-62 PFAM
low complexity region 226 277 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102866
AA Change: S182P

PolyPhen 2 Score 0.064 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000099930
Gene: ENSMUSG00000054766
AA Change: S182P

DomainStartEndE-ValueType
low complexity region 11 23 N/A INTRINSIC
Pfam:NAP 42 234 5.3e-39 PFAM
low complexity region 238 289 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125824
Predicted Effect probably benign
Transcript: ENSMUST00000134364
AA Change: S182P

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000114557
Gene: ENSMUSG00000054766
AA Change: S182P

DomainStartEndE-ValueType
low complexity region 11 23 N/A INTRINSIC
Pfam:NAP 41 215 3e-54 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137291
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147590
Predicted Effect probably benign
Transcript: ENSMUST00000149578
SMART Domains Protein: ENSMUSP00000119824
Gene: ENSMUSG00000054766

DomainStartEndE-ValueType
low complexity region 11 23 N/A INTRINSIC
Pfam:NAP 41 151 1.8e-36 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene inhibits acetylation of nucleosomes, especially histone H4, by histone acetylases (HAT). This inhibition is most likely accomplished by masking histone lysines from being acetylated, and the consequence is to silence HAT-dependent transcription. The encoded protein is part of a complex localized to the endoplasmic reticulum but is found in the nucleus and inhibits apoptosis following attack by cytotoxic T lymphocytes. This protein can also enhance DNA replication of the adenovirus genome. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022B05Rik T C 8: 124,663,023 Y54C probably damaging Het
9030624J02Rik T C 7: 118,811,874 F677L probably damaging Het
Adgrf4 A T 17: 42,667,863 H196Q probably damaging Het
Astn1 T G 1: 158,657,120 S918A probably benign Het
Cd79a A T 7: 24,899,357 K110N probably benign Het
Cdc34b C T 11: 94,742,288 Q105* probably null Het
Cdh23 T C 10: 60,312,587 D2667G probably damaging Het
Clpx G A 9: 65,317,493 G168R probably damaging Het
Col8a2 T C 4: 126,311,315 probably benign Het
Ddx27 G A 2: 167,033,755 E669K probably damaging Het
Dnah8 A T 17: 30,758,281 I2898F probably damaging Het
Dus2 T C 8: 106,048,662 Y274H probably damaging Het
Dync2h1 A G 9: 6,967,226 S4073P probably damaging Het
Dynlrb2 G A 8: 116,514,810 R31Q possibly damaging Het
Esyt1 C T 10: 128,511,951 V957I probably benign Het
Fhdc1 A T 3: 84,444,561 L1119Q probably benign Het
H2-T10 T C 17: 36,119,425 K212E probably benign Het
H60b A T 10: 22,286,215 N113I probably benign Het
Hace1 A C 10: 45,700,625 K798Q probably benign Het
Hdac7 C T 15: 97,798,270 R631H probably damaging Het
Kat7 T A 11: 95,300,102 I153F probably benign Het
Lman1 T C 18: 65,998,610 T101A probably benign Het
Mapk8 A T 14: 33,388,936 C245* probably null Het
Mfhas1 T A 8: 35,591,277 W969R probably damaging Het
Mlxipl A T 5: 135,106,999 D26V probably damaging Het
Msh5 A G 17: 35,046,040 V53A probably benign Het
Msl2 C A 9: 101,101,984 A519D probably damaging Het
Nbeal1 A G 1: 60,206,344 S176G probably benign Het
Ninl T A 2: 150,975,843 K134* probably null Het
Olfr1240 C A 2: 89,439,345 M311I probably benign Het
Olfr384 T A 11: 73,603,413 Y278N probably damaging Het
Olfr959 A G 9: 39,572,987 S91P probably damaging Het
Pabpn1 T G 14: 54,897,152 I250S probably damaging Het
Ppp4r4 G A 12: 103,576,280 probably null Het
Rad51ap2 T C 12: 11,457,024 S316P possibly damaging Het
Scn7a C A 2: 66,737,436 W271C probably damaging Het
Sez6l T C 5: 112,472,752 T321A possibly damaging Het
Sfpq A T 4: 127,021,502 H29L unknown Het
Slc33a1 A G 3: 63,948,156 L356P probably damaging Het
Sptbn1 C G 11: 30,159,293 probably null Het
Srrd C T 5: 112,338,450 G179D probably benign Het
Taf4b T C 18: 14,807,399 S312P probably damaging Het
Tgfbrap1 A T 1: 43,054,634 L566* probably null Het
Tln2 T A 9: 67,397,653 M1L probably benign Het
Ttc27 T C 17: 74,856,502 F702L probably benign Het
Vmn2r54 C T 7: 12,629,710 G419R possibly damaging Het
Vps13b A G 15: 35,884,741 S3187G probably damaging Het
Vps13d C A 4: 145,181,115 probably null Het
Zfp568 A T 7: 29,989,082 E23V probably null Het
Other mutations in Set
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02169:Set APN 2 30069524 missense possibly damaging 0.47
R1507:Set UTSW 2 30069094 missense probably damaging 0.99
R1694:Set UTSW 2 30069424 missense probably damaging 0.98
R2058:Set UTSW 2 30069036 missense possibly damaging 0.94
R4229:Set UTSW 2 30069519 missense probably damaging 1.00
R5347:Set UTSW 2 30069410 missense possibly damaging 0.76
R6147:Set UTSW 2 30066824 missense probably benign 0.44
Predicted Primers PCR Primer
(F):5'- TCAGACAGTTGATAGGTGTATCC -3'
(R):5'- AGGCAATGTTCTTTTAGGGACTC -3'

Sequencing Primer
(F):5'- AGGTGTATCCTATGAAAGCAATTTAC -3'
(R):5'- GGGACTCATTCATTCTATTGGACAC -3'
Posted On2014-08-25