Incidental Mutation 'R1991:Piezo2'
ID225276
Institutional Source Beutler Lab
Gene Symbol Piezo2
Ensembl Gene ENSMUSG00000041482
Gene Namepiezo-type mechanosensitive ion channel component 2
SynonymsFam38b, Fam38b2, 9030411M15Rik, Piezo2, 9430028L06Rik
MMRRC Submission 040002-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1991 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location63010213-63387183 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 63074662 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 1426 (L1426Q)
Ref Sequence ENSEMBL: ENSMUSP00000138758 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047480] [ENSMUST00000182233] [ENSMUST00000183217]
Predicted Effect probably null
Transcript: ENSMUST00000047480
AA Change: L1440Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000040019
Gene: ENSMUSG00000041482
AA Change: L1440Q

DomainStartEndE-ValueType
transmembrane domain 13 44 N/A INTRINSIC
transmembrane domain 59 81 N/A INTRINSIC
low complexity region 179 194 N/A INTRINSIC
transmembrane domain 214 236 N/A INTRINSIC
transmembrane domain 241 260 N/A INTRINSIC
transmembrane domain 267 289 N/A INTRINSIC
coiled coil region 455 482 N/A INTRINSIC
transmembrane domain 504 526 N/A INTRINSIC
transmembrane domain 539 561 N/A INTRINSIC
SCOP:d1eq1a_ 597 666 4e-3 SMART
transmembrane domain 682 704 N/A INTRINSIC
transmembrane domain 708 730 N/A INTRINSIC
internal_repeat_1 740 764 6.01e-5 PROSPERO
low complexity region 772 784 N/A INTRINSIC
transmembrane domain 791 813 N/A INTRINSIC
low complexity region 900 921 N/A INTRINSIC
transmembrane domain 949 971 N/A INTRINSIC
transmembrane domain 976 993 N/A INTRINSIC
transmembrane domain 1000 1022 N/A INTRINSIC
transmembrane domain 1069 1091 N/A INTRINSIC
transmembrane domain 1130 1152 N/A INTRINSIC
transmembrane domain 1156 1173 N/A INTRINSIC
transmembrane domain 1186 1208 N/A INTRINSIC
transmembrane domain 1234 1256 N/A INTRINSIC
transmembrane domain 1308 1327 N/A INTRINSIC
transmembrane domain 1331 1353 N/A INTRINSIC
Pfam:PIEZO 1383 1617 1.1e-105 PFAM
low complexity region 1807 1823 N/A INTRINSIC
low complexity region 1836 1860 N/A INTRINSIC
low complexity region 1863 1878 N/A INTRINSIC
transmembrane domain 1981 2003 N/A INTRINSIC
transmembrane domain 2010 2027 N/A INTRINSIC
internal_repeat_1 2036 2060 6.01e-5 PROSPERO
low complexity region 2167 2199 N/A INTRINSIC
transmembrane domain 2261 2283 N/A INTRINSIC
transmembrane domain 2303 2325 N/A INTRINSIC
transmembrane domain 2332 2354 N/A INTRINSIC
transmembrane domain 2364 2386 N/A INTRINSIC
Pfam:Piezo_RRas_bdg 2412 2821 2.8e-161 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000182233
SMART Domains Protein: ENSMUSP00000138170
Gene: ENSMUSG00000041482

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
transmembrane domain 34 56 N/A INTRINSIC
coiled coil region 223 250 N/A INTRINSIC
transmembrane domain 272 294 N/A INTRINSIC
transmembrane domain 307 329 N/A INTRINSIC
SCOP:d1eq1a_ 365 434 1e-3 SMART
transmembrane domain 450 472 N/A INTRINSIC
transmembrane domain 476 498 N/A INTRINSIC
transmembrane domain 505 527 N/A INTRINSIC
low complexity region 540 552 N/A INTRINSIC
transmembrane domain 559 581 N/A INTRINSIC
low complexity region 668 689 N/A INTRINSIC
transmembrane domain 717 739 N/A INTRINSIC
transmembrane domain 744 761 N/A INTRINSIC
transmembrane domain 768 790 N/A INTRINSIC
transmembrane domain 837 859 N/A INTRINSIC
transmembrane domain 898 920 N/A INTRINSIC
transmembrane domain 924 941 N/A INTRINSIC
transmembrane domain 954 976 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000183217
AA Change: L1426Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138758
Gene: ENSMUSG00000041482
AA Change: L1426Q

DomainStartEndE-ValueType
transmembrane domain 13 44 N/A INTRINSIC
transmembrane domain 59 81 N/A INTRINSIC
low complexity region 179 194 N/A INTRINSIC
transmembrane domain 214 236 N/A INTRINSIC
transmembrane domain 241 260 N/A INTRINSIC
transmembrane domain 267 289 N/A INTRINSIC
coiled coil region 455 482 N/A INTRINSIC
transmembrane domain 504 526 N/A INTRINSIC
transmembrane domain 539 561 N/A INTRINSIC
SCOP:d1eq1a_ 597 666 4e-3 SMART
transmembrane domain 682 704 N/A INTRINSIC
transmembrane domain 708 730 N/A INTRINSIC
transmembrane domain 737 759 N/A INTRINSIC
low complexity region 772 784 N/A INTRINSIC
transmembrane domain 791 813 N/A INTRINSIC
low complexity region 886 907 N/A INTRINSIC
transmembrane domain 935 957 N/A INTRINSIC
transmembrane domain 962 979 N/A INTRINSIC
transmembrane domain 986 1008 N/A INTRINSIC
transmembrane domain 1055 1077 N/A INTRINSIC
transmembrane domain 1116 1138 N/A INTRINSIC
transmembrane domain 1142 1159 N/A INTRINSIC
transmembrane domain 1172 1194 N/A INTRINSIC
transmembrane domain 1220 1242 N/A INTRINSIC
transmembrane domain 1294 1313 N/A INTRINSIC
transmembrane domain 1317 1339 N/A INTRINSIC
transmembrane domain 1352 1374 N/A INTRINSIC
coiled coil region 1460 1501 N/A INTRINSIC
low complexity region 1528 1537 N/A INTRINSIC
low complexity region 1558 1575 N/A INTRINSIC
Meta Mutation Damage Score 0.274 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.3%
Validation Efficiency 100% (124/124)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains more than thirty transmembrane domains and likely functions as part of mechanically-activated (MA) cation channels. These channels serve to connect mechanical forces to biological signals. The encoded protein quickly adapts MA currents in somatosensory neurons. Defects in this gene are a cause of type 5 distal arthrogryposis. Several alternatively spliced transcript variants of this gene have been described, but their full-length nature is not known. [provided by RefSeq, Feb 2014]
Allele List at MGI
Other mutations in this stock
Total: 123 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik C T 3: 138,065,658 R203* probably null Het
Abcc2 A T 19: 43,807,142 I446F probably damaging Het
Afap1l2 A T 19: 57,002,267 I18N possibly damaging Het
Aida A T 1: 183,313,692 E107D probably benign Het
Amer2 A G 14: 60,379,820 Y362C probably damaging Het
Amigo1 T C 3: 108,187,328 S48P probably benign Het
Ano5 A G 7: 51,537,813 K50R possibly damaging Het
Anxa2 A T 9: 69,483,816 D95V probably damaging Het
Arhgap22 A G 14: 33,366,959 N466D probably damaging Het
Armc3 T C 2: 19,293,142 Y575H probably damaging Het
Ascc2 A G 11: 4,679,257 E523G probably benign Het
B3galt5 A T 16: 96,316,025 K286M probably damaging Het
Bag3 C T 7: 128,545,683 H341Y probably benign Het
Blm G T 7: 80,505,949 probably null Het
Cacna1b G A 2: 24,732,306 P222L probably damaging Het
Cap2 T A 13: 46,637,881 Y175N possibly damaging Het
Cd81 G T 7: 143,067,201 G206* probably null Het
Cep290 T A 10: 100,531,184 S1132R possibly damaging Het
Cluh C A 11: 74,659,529 C222* probably null Het
Col14a1 A T 15: 55,449,940 D1320V unknown Het
Col18a1 T C 10: 77,081,154 I114V unknown Het
Cped1 A G 6: 22,233,927 T847A probably damaging Het
Cpne7 A G 8: 123,127,437 K288E possibly damaging Het
Cr2 G A 1: 195,154,150 P1278S possibly damaging Het
Creb3 C A 4: 43,565,327 R202S probably damaging Het
Cyp2j9 T A 4: 96,571,964 K434M probably damaging Het
Dpp10 A T 1: 123,905,106 V48E probably null Het
Dsg2 A G 18: 20,601,473 K836R probably damaging Het
Dst A G 1: 34,190,258 T1986A probably benign Het
Dvl1 G A 4: 155,847,816 V28I possibly damaging Het
Ecm2 A G 13: 49,530,256 D570G probably benign Het
Efhc1 T A 1: 20,989,560 C611* probably null Het
Epop T C 11: 97,628,654 T210A probably benign Het
Erc2 A G 14: 28,011,636 I556V probably benign Het
Fdxacb1 A T 9: 50,771,646 N101I probably benign Het
Fhad1 T C 4: 141,982,162 S294G possibly damaging Het
Galnt16 A G 12: 80,583,656 D262G probably damaging Het
Gm9573 A T 17: 35,618,708 S1529T probably benign Het
Gorab A G 1: 163,397,056 S59P probably damaging Het
Gpr161 G T 1: 165,306,563 M131I probably damaging Het
Gpr22 T A 12: 31,709,203 M270L probably benign Het
Grin3b C A 10: 79,970,912 Q5K probably benign Het
Grin3b C T 10: 79,974,646 A662V probably damaging Het
Gsdmc A G 15: 63,801,899 I179T probably benign Het
Gsdmc2 T A 15: 63,828,237 M229L probably benign Het
H2-Eb2 A G 17: 34,334,304 I155V probably benign Het
Hoga1 A C 19: 42,060,020 probably null Het
Hs3st5 A G 10: 36,832,886 Y139C probably damaging Het
Il10ra C A 9: 45,255,811 A481S probably benign Het
Ints2 T A 11: 86,248,934 H278L possibly damaging Het
Kalrn T G 16: 33,975,738 L1222F probably damaging Het
Klhl25 T A 7: 75,866,732 V157D probably damaging Het
Klk1b26 A T 7: 44,016,900 T256S probably damaging Het
Krt81 T C 15: 101,462,554 Q184R probably benign Het
Lce1k A T 3: 92,806,818 C20S unknown Het
Letm1 A AG 5: 33,769,515 probably null Het
Lin54 A G 5: 100,485,801 probably null Het
Lrrc37a T C 11: 103,500,261 E1446G probably benign Het
Macf1 A G 4: 123,456,695 S3792P probably damaging Het
Manba T A 3: 135,551,191 D538E probably benign Het
Mcc C A 18: 44,491,315 E213* probably null Het
Mfap4 T C 11: 61,485,807 probably null Het
Nebl T A 2: 17,452,510 I80F probably damaging Het
Nek4 A G 14: 30,956,953 I145V probably damaging Het
Nlrp14 T C 7: 107,196,200 V230A probably benign Het
Nxf3 G A X: 136,075,834 P380S possibly damaging Het
Olfr1451 T C 19: 12,999,502 V172A possibly damaging Het
Olfr403 T C 11: 74,196,163 V220A probably damaging Het
Olfr421-ps1 C T 1: 174,152,121 H202Y probably damaging Het
Olfr490 C A 7: 108,286,359 G256* probably null Het
Olfr745 G A 14: 50,642,866 C195Y possibly damaging Het
Pcdhb13 C T 18: 37,443,859 T430I possibly damaging Het
Pigk T A 3: 152,744,494 Y212N probably damaging Het
Pigm T G 1: 172,377,261 L188R probably damaging Het
Plce1 T C 19: 38,777,924 F2117S probably damaging Het
Plec A G 15: 76,173,543 F4055L probably damaging Het
Plk5 C T 10: 80,363,102 S435L possibly damaging Het
Pms1 G A 1: 53,282,042 L11F probably damaging Het
Prl3b1 C T 13: 27,247,912 T140I possibly damaging Het
Prl7a1 T G 13: 27,633,672 D203A probably damaging Het
Psg17 A G 7: 18,814,652 V398A probably benign Het
Pum1 T A 4: 130,718,218 I166K possibly damaging Het
R3hdm1 T A 1: 128,169,016 D108E probably damaging Het
Reln A T 5: 21,969,360 D1948E possibly damaging Het
Rnf112 C T 11: 61,452,426 R141Q probably damaging Het
Rnf145 T C 11: 44,561,466 V424A possibly damaging Het
Serpina3m C A 12: 104,389,699 Y208* probably null Het
Serpind1 T C 16: 17,342,944 V446A probably benign Het
Shc3 T A 13: 51,442,836 M384L probably benign Het
Slc38a11 A G 2: 65,330,339 F304L probably benign Het
Slpi C T 2: 164,355,543 C28Y probably damaging Het
Specc1 C A 11: 62,029,294 P7T possibly damaging Het
Spib T C 7: 44,528,857 E180G probably benign Het
Spint5 T C 2: 164,716,983 probably benign Het
Ssr2 T A 3: 88,576,867 probably benign Het
Tbrg1 T C 9: 37,649,419 D387G probably benign Het
Tex14 T G 11: 87,549,470 L1367R probably damaging Het
Tfpi A C 2: 84,458,016 probably benign Het
Tlr5 T A 1: 182,974,347 D405E probably damaging Het
Tnnt3 C T 7: 142,511,525 R131C possibly damaging Het
Tnxb T C 17: 34,671,904 V407A probably damaging Het
Tnxb A G 17: 34,682,251 Y1013C probably damaging Het
Tpx2 T A 2: 152,890,624 M606K probably benign Het
Trim30a T A 7: 104,430,230 probably benign Het
Trim46 A T 3: 89,237,701 Y489N probably damaging Het
Trpm6 A T 19: 18,796,284 H380L probably benign Het
Tstd2 A G 4: 46,120,563 I279T probably benign Het
Ttn C T 2: 76,946,391 probably null Het
Txnl1 T C 18: 63,679,514 T70A probably benign Het
Ush2a C T 1: 188,578,532 probably benign Het
Usp1 A G 4: 98,934,294 D615G probably benign Het
Virma T A 4: 11,519,242 C830S probably benign Het
Vmn1r7 A T 6: 57,024,868 S136T probably benign Het
Vmn2r9 A G 5: 108,846,439 V448A probably damaging Het
Vps11 G A 9: 44,359,227 H183Y probably damaging Het
Vsig10l A G 7: 43,467,468 T476A possibly damaging Het
Wdr63 G T 3: 146,063,480 T522K possibly damaging Het
Whamm C T 7: 81,591,771 R277* probably null Het
Wnt8a A G 18: 34,544,884 D115G probably damaging Het
Xndc1 T A 7: 102,073,191 V21E probably damaging Het
Zc3hav1 C A 6: 38,336,517 V198L probably damaging Het
Zfp874a T A 13: 67,442,504 I354F probably benign Het
Zfr2 A T 10: 81,242,852 D306V possibly damaging Het
Other mutations in Piezo2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01360:Piezo2 APN 18 63117699 missense probably damaging 1.00
IGL01370:Piezo2 APN 18 63022460 missense probably damaging 1.00
IGL01543:Piezo2 APN 18 63070030 missense probably damaging 1.00
IGL01561:Piezo2 APN 18 63124614 missense probably benign 0.03
IGL01568:Piezo2 APN 18 63030392 missense probably benign 0.28
IGL01653:Piezo2 APN 18 63182833 splice site probably benign
IGL01674:Piezo2 APN 18 63027559 missense probably damaging 1.00
IGL01684:Piezo2 APN 18 63083170 missense probably damaging 1.00
IGL01744:Piezo2 APN 18 63042788 missense probably damaging 1.00
IGL01859:Piezo2 APN 18 63092844 missense probably benign 0.10
IGL02183:Piezo2 APN 18 63020634 missense probably benign 0.00
IGL02407:Piezo2 APN 18 63146844 missense probably damaging 1.00
IGL02441:Piezo2 APN 18 63072862 missense probably damaging 1.00
IGL02542:Piezo2 APN 18 63032924 missense probably damaging 0.96
IGL02652:Piezo2 APN 18 63024475 missense probably damaging 1.00
IGL02710:Piezo2 APN 18 63074659 missense probably damaging 1.00
IGL02850:Piezo2 APN 18 63020633 missense probably benign 0.18
IGL02851:Piezo2 APN 18 63020633 missense probably benign 0.18
IGL02972:Piezo2 APN 18 63064785 splice site probably benign
IGL03011:Piezo2 APN 18 63124660 missense probably benign 0.03
IGL03078:Piezo2 APN 18 63070075 missense probably damaging 1.00
IGL03114:Piezo2 APN 18 63030272 splice site probably null
IGL03129:Piezo2 APN 18 63114972 missense probably benign
IGL03143:Piezo2 APN 18 63108076 missense probably damaging 0.99
IGL03202:Piezo2 APN 18 63011598 missense probably damaging 1.00
IGL03227:Piezo2 APN 18 63124606 missense probably damaging 1.00
IGL03228:Piezo2 APN 18 63053062 missense probably damaging 1.00
IGL03230:Piezo2 APN 18 63041720 missense probably damaging 1.00
IGL03242:Piezo2 APN 18 63011538 utr 3 prime probably benign
IGL03291:Piezo2 APN 18 63021308 missense probably damaging 1.00
IGL03301:Piezo2 APN 18 63027704 missense probably damaging 1.00
Piccolo UTSW 18 63011696 missense probably damaging 1.00
P0023:Piezo2 UTSW 18 63386200 splice site probably benign
PIT4802001:Piezo2 UTSW 18 63024469 missense probably damaging 1.00
R0070:Piezo2 UTSW 18 63102084 missense probably damaging 1.00
R0416:Piezo2 UTSW 18 63024491 missense probably damaging 1.00
R0486:Piezo2 UTSW 18 63029061 missense probably damaging 1.00
R0498:Piezo2 UTSW 18 63102174 missense possibly damaging 0.87
R0504:Piezo2 UTSW 18 63024451 missense probably damaging 1.00
R0506:Piezo2 UTSW 18 63027544 missense probably damaging 1.00
R0523:Piezo2 UTSW 18 63022481 missense probably damaging 1.00
R0587:Piezo2 UTSW 18 63022426 missense possibly damaging 0.82
R0626:Piezo2 UTSW 18 63019258 missense probably damaging 0.97
R0734:Piezo2 UTSW 18 63041723 missense probably damaging 1.00
R0784:Piezo2 UTSW 18 63083235 missense probably damaging 1.00
R0973:Piezo2 UTSW 18 63015802 missense probably damaging 1.00
R1183:Piezo2 UTSW 18 63086753 missense probably damaging 1.00
R1344:Piezo2 UTSW 18 63021254 missense probably damaging 1.00
R1474:Piezo2 UTSW 18 63083131 missense probably damaging 1.00
R1571:Piezo2 UTSW 18 63144919 missense possibly damaging 0.67
R1643:Piezo2 UTSW 18 63082915 missense probably benign 0.03
R1649:Piezo2 UTSW 18 63117672 missense probably benign 0.34
R1741:Piezo2 UTSW 18 63021173 missense probably damaging 1.00
R1764:Piezo2 UTSW 18 63124642 missense possibly damaging 0.50
R1793:Piezo2 UTSW 18 63106284 missense possibly damaging 0.78
R1799:Piezo2 UTSW 18 63032840 critical splice donor site probably null
R1799:Piezo2 UTSW 18 63108087 missense probably damaging 1.00
R1868:Piezo2 UTSW 18 63019344 missense probably damaging 1.00
R1879:Piezo2 UTSW 18 63113960 missense probably damaging 1.00
R1962:Piezo2 UTSW 18 63078840 missense probably damaging 0.98
R1990:Piezo2 UTSW 18 63074662 missense probably null 1.00
R1992:Piezo2 UTSW 18 63074662 missense probably null 1.00
R1995:Piezo2 UTSW 18 63078781 missense probably damaging 1.00
R2004:Piezo2 UTSW 18 63144926 missense probably damaging 1.00
R2011:Piezo2 UTSW 18 63059744 missense probably damaging 1.00
R2029:Piezo2 UTSW 18 63118935 missense possibly damaging 0.62
R2075:Piezo2 UTSW 18 63081734 missense probably damaging 1.00
R2078:Piezo2 UTSW 18 63117720 missense probably damaging 0.99
R2152:Piezo2 UTSW 18 63114041 missense probably damaging 1.00
R2162:Piezo2 UTSW 18 63081662 critical splice donor site probably null
R2183:Piezo2 UTSW 18 63106274 missense probably damaging 1.00
R2230:Piezo2 UTSW 18 63145072 missense probably damaging 1.00
R2231:Piezo2 UTSW 18 63145072 missense probably damaging 1.00
R2406:Piezo2 UTSW 18 63022525 missense probably damaging 1.00
R2431:Piezo2 UTSW 18 63245624 missense possibly damaging 0.95
R2876:Piezo2 UTSW 18 63053035 missense probably damaging 1.00
R2935:Piezo2 UTSW 18 63146843 missense probably damaging 1.00
R3004:Piezo2 UTSW 18 63024435 nonsense probably null
R3016:Piezo2 UTSW 18 63042832 missense probably damaging 1.00
R3794:Piezo2 UTSW 18 63081793 missense probably damaging 0.99
R3832:Piezo2 UTSW 18 63081662 critical splice donor site probably null
R3833:Piezo2 UTSW 18 63081662 critical splice donor site probably null
R3968:Piezo2 UTSW 18 63011696 missense probably damaging 1.00
R3969:Piezo2 UTSW 18 63011696 missense probably damaging 1.00
R3970:Piezo2 UTSW 18 63011696 missense probably damaging 1.00
R4169:Piezo2 UTSW 18 63050604 missense probably benign
R4181:Piezo2 UTSW 18 63124730 critical splice acceptor site probably null
R4301:Piezo2 UTSW 18 63084840 missense probably damaging 1.00
R4302:Piezo2 UTSW 18 63124730 critical splice acceptor site probably null
R4475:Piezo2 UTSW 18 63102099 missense probably damaging 1.00
R4493:Piezo2 UTSW 18 63114063 missense probably damaging 0.98
R4519:Piezo2 UTSW 18 63072880 missense probably damaging 1.00
R4539:Piezo2 UTSW 18 63086628 missense probably damaging 1.00
R4687:Piezo2 UTSW 18 63069963 missense probably damaging 1.00
R4732:Piezo2 UTSW 18 63030401 missense probably damaging 1.00
R4733:Piezo2 UTSW 18 63030401 missense probably damaging 1.00
R4825:Piezo2 UTSW 18 63144954 missense probably damaging 0.98
R4899:Piezo2 UTSW 18 63078791 missense possibly damaging 0.84
R4946:Piezo2 UTSW 18 63157262 missense probably benign
R4961:Piezo2 UTSW 18 63052961 splice site probably null
R4968:Piezo2 UTSW 18 63144971 nonsense probably null
R4973:Piezo2 UTSW 18 63074680 missense probably damaging 1.00
R4997:Piezo2 UTSW 18 63083113 missense probably damaging 1.00
R5078:Piezo2 UTSW 18 63024536 missense probably damaging 1.00
R5134:Piezo2 UTSW 18 63074620 missense probably damaging 1.00
R5151:Piezo2 UTSW 18 63030409 missense possibly damaging 0.72
R5209:Piezo2 UTSW 18 63032929 missense probably damaging 1.00
R5367:Piezo2 UTSW 18 63064731 missense probably damaging 1.00
R5401:Piezo2 UTSW 18 63084740 missense possibly damaging 0.81
R5464:Piezo2 UTSW 18 63145105 missense probably damaging 1.00
R5469:Piezo2 UTSW 18 63027864 missense probably damaging 1.00
R5650:Piezo2 UTSW 18 63011721 missense probably damaging 1.00
R5654:Piezo2 UTSW 18 63145091 missense possibly damaging 0.94
R5677:Piezo2 UTSW 18 63117696 missense possibly damaging 0.94
R5677:Piezo2 UTSW 18 63117697 missense probably benign 0.25
R5792:Piezo2 UTSW 18 63146856 missense probably damaging 1.00
R5874:Piezo2 UTSW 18 63027901 missense probably damaging 1.00
R5877:Piezo2 UTSW 18 63113934 missense probably benign 0.22
R6036:Piezo2 UTSW 18 63114948 nonsense probably null
R6036:Piezo2 UTSW 18 63114948 nonsense probably null
R6073:Piezo2 UTSW 18 63012645 missense probably damaging 1.00
R6198:Piezo2 UTSW 18 63157210 nonsense probably null
R6255:Piezo2 UTSW 18 63121270 missense possibly damaging 0.75
R6259:Piezo2 UTSW 18 63117678 missense possibly damaging 0.69
R6391:Piezo2 UTSW 18 63106293 missense possibly damaging 0.79
R6446:Piezo2 UTSW 18 63086607 missense probably damaging 1.00
R6465:Piezo2 UTSW 18 63041663 missense possibly damaging 0.82
R6518:Piezo2 UTSW 18 63106271 missense probably damaging 0.99
R6521:Piezo2 UTSW 18 63021328 missense probably damaging 1.00
R6625:Piezo2 UTSW 18 63021262 missense probably damaging 1.00
R6744:Piezo2 UTSW 18 63032889 nonsense probably null
R6855:Piezo2 UTSW 18 63090879 critical splice donor site probably null
R6927:Piezo2 UTSW 18 63032986 missense probably damaging 1.00
R6980:Piezo2 UTSW 18 63082961 critical splice acceptor site probably null
R7141:Piezo2 UTSW 18 63145110 nonsense probably null
R7162:Piezo2 UTSW 18 63124709 missense possibly damaging 0.50
X0017:Piezo2 UTSW 18 63027586 missense probably damaging 0.99
X0022:Piezo2 UTSW 18 63050610 missense probably benign 0.43
X0060:Piezo2 UTSW 18 63017577 missense probably benign 0.09
Z1088:Piezo2 UTSW 18 63069994 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CTGGTGTCCAGTCCTTTAGG -3'
(R):5'- TCCCAAGCCTGGTTCTGTAG -3'

Sequencing Primer
(F):5'- TGTGTGTGTGTGAGAGAGAGAGAG -3'
(R):5'- CTGTAGACTTTATACAACCGGGAG -3'
Posted On2014-08-25