Incidental Mutation 'R2038:Fhdc1'
ID225280
Institutional Source Beutler Lab
Gene Symbol Fhdc1
Ensembl Gene ENSMUSG00000041842
Gene NameFH2 domain containing 1
Synonyms6330505N24Rik
MMRRC Submission 040045-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.383) question?
Stock #R2038 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location84442198-84480429 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 84444561 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 1119 (L1119Q)
Ref Sequence ENSEMBL: ENSMUSP00000103317 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091002] [ENSMUST00000107689] [ENSMUST00000194027]
Predicted Effect probably benign
Transcript: ENSMUST00000091002
AA Change: L1119Q

PolyPhen 2 Score 0.216 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000088525
Gene: ENSMUSG00000041842
AA Change: L1119Q

DomainStartEndE-ValueType
low complexity region 30 48 N/A INTRINSIC
low complexity region 55 82 N/A INTRINSIC
FH2 88 538 5.13e-57 SMART
Blast:FH2 539 571 6e-6 BLAST
low complexity region 789 822 N/A INTRINSIC
low complexity region 962 976 N/A INTRINSIC
low complexity region 1009 1026 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107689
AA Change: L1119Q

PolyPhen 2 Score 0.216 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000103317
Gene: ENSMUSG00000041842
AA Change: L1119Q

DomainStartEndE-ValueType
low complexity region 30 48 N/A INTRINSIC
low complexity region 55 82 N/A INTRINSIC
FH2 88 538 5.13e-57 SMART
Blast:FH2 539 571 6e-6 BLAST
low complexity region 789 822 N/A INTRINSIC
low complexity region 962 976 N/A INTRINSIC
low complexity region 1009 1026 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125643
Predicted Effect probably benign
Transcript: ENSMUST00000194027
SMART Domains Protein: ENSMUSP00000142030
Gene: ENSMUSG00000041842

DomainStartEndE-ValueType
Pfam:FH2 1 145 3.8e-22 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022B05Rik T C 8: 124,663,023 Y54C probably damaging Het
9030624J02Rik T C 7: 118,811,874 F677L probably damaging Het
Adgrf4 A T 17: 42,667,863 H196Q probably damaging Het
Astn1 T G 1: 158,657,120 S918A probably benign Het
Cd79a A T 7: 24,899,357 K110N probably benign Het
Cdc34b C T 11: 94,742,288 Q105* probably null Het
Cdh23 T C 10: 60,312,587 D2667G probably damaging Het
Clpx G A 9: 65,317,493 G168R probably damaging Het
Col8a2 T C 4: 126,311,315 probably benign Het
Ddx27 G A 2: 167,033,755 E669K probably damaging Het
Dnah8 A T 17: 30,758,281 I2898F probably damaging Het
Dus2 T C 8: 106,048,662 Y274H probably damaging Het
Dync2h1 A G 9: 6,967,226 S4073P probably damaging Het
Dynlrb2 G A 8: 116,514,810 R31Q possibly damaging Het
Esyt1 C T 10: 128,511,951 V957I probably benign Het
H2-T10 T C 17: 36,119,425 K212E probably benign Het
H60b A T 10: 22,286,215 N113I probably benign Het
Hace1 A C 10: 45,700,625 K798Q probably benign Het
Hdac7 C T 15: 97,798,270 R631H probably damaging Het
Kat7 T A 11: 95,300,102 I153F probably benign Het
Lman1 T C 18: 65,998,610 T101A probably benign Het
Mapk8 A T 14: 33,388,936 C245* probably null Het
Mfhas1 T A 8: 35,591,277 W969R probably damaging Het
Mlxipl A T 5: 135,106,999 D26V probably damaging Het
Msh5 A G 17: 35,046,040 V53A probably benign Het
Msl2 C A 9: 101,101,984 A519D probably damaging Het
Nbeal1 A G 1: 60,206,344 S176G probably benign Het
Ninl T A 2: 150,975,843 K134* probably null Het
Olfr1240 C A 2: 89,439,345 M311I probably benign Het
Olfr384 T A 11: 73,603,413 Y278N probably damaging Het
Olfr959 A G 9: 39,572,987 S91P probably damaging Het
Pabpn1 T G 14: 54,897,152 I250S probably damaging Het
Ppp4r4 G A 12: 103,576,280 probably null Het
Rad51ap2 T C 12: 11,457,024 S316P possibly damaging Het
Scn7a C A 2: 66,737,436 W271C probably damaging Het
Set T C 2: 30,070,200 S182P probably benign Het
Sez6l T C 5: 112,472,752 T321A possibly damaging Het
Sfpq A T 4: 127,021,502 H29L unknown Het
Slc33a1 A G 3: 63,948,156 L356P probably damaging Het
Sptbn1 C G 11: 30,159,293 probably null Het
Srrd C T 5: 112,338,450 G179D probably benign Het
Taf4b T C 18: 14,807,399 S312P probably damaging Het
Tgfbrap1 A T 1: 43,054,634 L566* probably null Het
Tln2 T A 9: 67,397,653 M1L probably benign Het
Ttc27 T C 17: 74,856,502 F702L probably benign Het
Vmn2r54 C T 7: 12,629,710 G419R possibly damaging Het
Vps13b A G 15: 35,884,741 S3187G probably damaging Het
Vps13d C A 4: 145,181,115 probably null Het
Zfp568 A T 7: 29,989,082 E23V probably null Het
Other mutations in Fhdc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00507:Fhdc1 APN 3 84448800 missense probably damaging 1.00
IGL00556:Fhdc1 APN 3 84457242 missense possibly damaging 0.81
IGL00951:Fhdc1 APN 3 84464313 missense possibly damaging 0.90
IGL01744:Fhdc1 APN 3 84444735 missense possibly damaging 0.66
IGL01754:Fhdc1 APN 3 84444735 missense possibly damaging 0.66
IGL01762:Fhdc1 APN 3 84444735 missense possibly damaging 0.66
IGL01764:Fhdc1 APN 3 84444735 missense possibly damaging 0.66
IGL01769:Fhdc1 APN 3 84444735 missense possibly damaging 0.66
IGL01778:Fhdc1 APN 3 84444735 missense possibly damaging 0.66
IGL01779:Fhdc1 APN 3 84444735 missense possibly damaging 0.66
IGL01781:Fhdc1 APN 3 84444735 missense possibly damaging 0.66
IGL02243:Fhdc1 APN 3 84474640 start codon destroyed possibly damaging 0.89
IGL02260:Fhdc1 APN 3 84444735 missense possibly damaging 0.66
IGL02261:Fhdc1 APN 3 84444735 missense possibly damaging 0.66
IGL02266:Fhdc1 APN 3 84444735 missense possibly damaging 0.66
IGL02271:Fhdc1 APN 3 84444735 missense possibly damaging 0.66
IGL02284:Fhdc1 APN 3 84444735 missense possibly damaging 0.66
IGL02292:Fhdc1 APN 3 84444735 missense possibly damaging 0.66
IGL02296:Fhdc1 APN 3 84444735 missense possibly damaging 0.66
IGL02301:Fhdc1 APN 3 84444735 missense possibly damaging 0.66
IGL02347:Fhdc1 APN 3 84444735 missense possibly damaging 0.66
IGL02416:Fhdc1 APN 3 84445228 missense probably benign 0.03
IGL03189:Fhdc1 APN 3 84455061 intron probably benign
IGL03392:Fhdc1 APN 3 84444519 missense possibly damaging 0.55
R0125:Fhdc1 UTSW 3 84445545 missense probably benign
R0135:Fhdc1 UTSW 3 84445618 missense probably damaging 0.97
R0255:Fhdc1 UTSW 3 84453510 intron probably benign
R0401:Fhdc1 UTSW 3 84444624 missense probably benign 0.02
R1371:Fhdc1 UTSW 3 84445003 missense probably damaging 1.00
R1727:Fhdc1 UTSW 3 84446176 missense possibly damaging 0.50
R1769:Fhdc1 UTSW 3 84448778 missense probably damaging 1.00
R1781:Fhdc1 UTSW 3 84448804 missense probably damaging 0.99
R1840:Fhdc1 UTSW 3 84445821 missense possibly damaging 0.46
R1970:Fhdc1 UTSW 3 84454851 missense probably damaging 1.00
R2088:Fhdc1 UTSW 3 84474726 start gained probably benign
R2256:Fhdc1 UTSW 3 84446046 missense probably benign
R2939:Fhdc1 UTSW 3 84457270 missense possibly damaging 0.47
R3813:Fhdc1 UTSW 3 84464270 critical splice donor site probably null
R4022:Fhdc1 UTSW 3 84445102 missense probably benign 0.01
R4175:Fhdc1 UTSW 3 84456987 intron probably benign
R4243:Fhdc1 UTSW 3 84444826 missense probably benign 0.42
R4245:Fhdc1 UTSW 3 84444826 missense probably benign 0.42
R4290:Fhdc1 UTSW 3 84444826 missense probably benign 0.42
R4291:Fhdc1 UTSW 3 84444826 missense probably benign 0.42
R4292:Fhdc1 UTSW 3 84444826 missense probably benign 0.42
R4293:Fhdc1 UTSW 3 84444826 missense probably benign 0.42
R4294:Fhdc1 UTSW 3 84444826 missense probably benign 0.42
R4295:Fhdc1 UTSW 3 84444826 missense probably benign 0.42
R4334:Fhdc1 UTSW 3 84444826 missense probably benign 0.42
R4335:Fhdc1 UTSW 3 84444826 missense probably benign 0.42
R4342:Fhdc1 UTSW 3 84444826 missense probably benign 0.42
R4344:Fhdc1 UTSW 3 84444826 missense probably benign 0.42
R4354:Fhdc1 UTSW 3 84444826 missense probably benign 0.42
R4550:Fhdc1 UTSW 3 84445176 missense probably benign 0.16
R4626:Fhdc1 UTSW 3 84474250 missense probably damaging 1.00
R4925:Fhdc1 UTSW 3 84453533 missense probably damaging 1.00
R5155:Fhdc1 UTSW 3 84446150 missense probably benign 0.00
R5588:Fhdc1 UTSW 3 84465476 missense possibly damaging 0.91
R6043:Fhdc1 UTSW 3 84448886 missense probably damaging 0.96
R6063:Fhdc1 UTSW 3 84446029 missense probably benign 0.00
R6652:Fhdc1 UTSW 3 84464324 missense probably damaging 1.00
R6706:Fhdc1 UTSW 3 84446422 missense probably damaging 1.00
R6783:Fhdc1 UTSW 3 84445527 missense probably benign 0.00
R6984:Fhdc1 UTSW 3 84444516 missense possibly damaging 0.93
R7182:Fhdc1 UTSW 3 84448850 missense probably damaging 0.98
R7299:Fhdc1 UTSW 3 84444540 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTAAGACTGGCCTCTGTGTCC -3'
(R):5'- GAAATACGGTGGCCTCGTCATC -3'

Sequencing Primer
(F):5'- GGCCTCTGTGTCCTCCCC -3'
(R):5'- TCATCTCGGAGCCTGCGAAC -3'
Posted On2014-08-25