Incidental Mutation 'R2038:Col8a2'
ID225283
Institutional Source Beutler Lab
Gene Symbol Col8a2
Ensembl Gene ENSMUSG00000056174
Gene Namecollagen, type VIII, alpha 2
Synonyms
MMRRC Submission 040045-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.401) question?
Stock #R2038 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location126286793-126314330 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to C at 126311315 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000123003 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070132] [ENSMUST00000102617] [ENSMUST00000128435]
Predicted Effect unknown
Transcript: ENSMUST00000070132
AA Change: S373P
SMART Domains Protein: ENSMUSP00000070270
Gene: ENSMUSG00000056174
AA Change: S373P

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
low complexity region 25 33 N/A INTRINSIC
low complexity region 60 69 N/A INTRINSIC
low complexity region 72 105 N/A INTRINSIC
Pfam:Collagen 116 168 1.2e-9 PFAM
low complexity region 207 237 N/A INTRINSIC
internal_repeat_1 240 259 1.3e-7 PROSPERO
low complexity region 260 327 N/A INTRINSIC
low complexity region 342 387 N/A INTRINSIC
internal_repeat_1 388 407 1.3e-7 PROSPERO
low complexity region 408 429 N/A INTRINSIC
low complexity region 440 459 N/A INTRINSIC
low complexity region 471 530 N/A INTRINSIC
low complexity region 545 557 N/A INTRINSIC
C1Q 564 699 2.44e-78 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102617
SMART Domains Protein: ENSMUSP00000099677
Gene: ENSMUSG00000042558

DomainStartEndE-ValueType
low complexity region 2 27 N/A INTRINSIC
Pfam:ADP_ribosyl_GH 31 344 1.5e-68 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128188
Predicted Effect probably benign
Transcript: ENSMUST00000128435
SMART Domains Protein: ENSMUSP00000123003
Gene: ENSMUSG00000056174

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
low complexity region 25 33 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151191
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the alpha 2 chain of type VIII collagen. This protein is a major component of the basement membrane of the corneal endothelium and forms homo- or heterotrimers with alpha 1 (VIII) type collagens. Defects in this gene are associated with Fuchs endothelial corneal dystrophy and posterior polymorphous corneal dystrophy type 2. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit a thinner Descemet's membrane of the cornea. Mice heterozygous or homozygous for an ENU-induced mutation exhibit thin cornea, corneal epithelium, stroma, and Descemet membrane, and enlarged anterior chamber. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022B05Rik T C 8: 124,663,023 Y54C probably damaging Het
9030624J02Rik T C 7: 118,811,874 F677L probably damaging Het
Adgrf4 A T 17: 42,667,863 H196Q probably damaging Het
Astn1 T G 1: 158,657,120 S918A probably benign Het
Cd79a A T 7: 24,899,357 K110N probably benign Het
Cdc34b C T 11: 94,742,288 Q105* probably null Het
Cdh23 T C 10: 60,312,587 D2667G probably damaging Het
Clpx G A 9: 65,317,493 G168R probably damaging Het
Ddx27 G A 2: 167,033,755 E669K probably damaging Het
Dnah8 A T 17: 30,758,281 I2898F probably damaging Het
Dus2 T C 8: 106,048,662 Y274H probably damaging Het
Dync2h1 A G 9: 6,967,226 S4073P probably damaging Het
Dynlrb2 G A 8: 116,514,810 R31Q possibly damaging Het
Esyt1 C T 10: 128,511,951 V957I probably benign Het
Fhdc1 A T 3: 84,444,561 L1119Q probably benign Het
H2-T10 T C 17: 36,119,425 K212E probably benign Het
H60b A T 10: 22,286,215 N113I probably benign Het
Hace1 A C 10: 45,700,625 K798Q probably benign Het
Hdac7 C T 15: 97,798,270 R631H probably damaging Het
Kat7 T A 11: 95,300,102 I153F probably benign Het
Lman1 T C 18: 65,998,610 T101A probably benign Het
Mapk8 A T 14: 33,388,936 C245* probably null Het
Mfhas1 T A 8: 35,591,277 W969R probably damaging Het
Mlxipl A T 5: 135,106,999 D26V probably damaging Het
Msh5 A G 17: 35,046,040 V53A probably benign Het
Msl2 C A 9: 101,101,984 A519D probably damaging Het
Nbeal1 A G 1: 60,206,344 S176G probably benign Het
Ninl T A 2: 150,975,843 K134* probably null Het
Olfr1240 C A 2: 89,439,345 M311I probably benign Het
Olfr384 T A 11: 73,603,413 Y278N probably damaging Het
Olfr959 A G 9: 39,572,987 S91P probably damaging Het
Pabpn1 T G 14: 54,897,152 I250S probably damaging Het
Ppp4r4 G A 12: 103,576,280 probably null Het
Rad51ap2 T C 12: 11,457,024 S316P possibly damaging Het
Scn7a C A 2: 66,737,436 W271C probably damaging Het
Set T C 2: 30,070,200 S182P probably benign Het
Sez6l T C 5: 112,472,752 T321A possibly damaging Het
Sfpq A T 4: 127,021,502 H29L unknown Het
Slc33a1 A G 3: 63,948,156 L356P probably damaging Het
Sptbn1 C G 11: 30,159,293 probably null Het
Srrd C T 5: 112,338,450 G179D probably benign Het
Taf4b T C 18: 14,807,399 S312P probably damaging Het
Tgfbrap1 A T 1: 43,054,634 L566* probably null Het
Tln2 T A 9: 67,397,653 M1L probably benign Het
Ttc27 T C 17: 74,856,502 F702L probably benign Het
Vmn2r54 C T 7: 12,629,710 G419R possibly damaging Het
Vps13b A G 15: 35,884,741 S3187G probably damaging Het
Vps13d C A 4: 145,181,115 probably null Het
Zfp568 A T 7: 29,989,082 E23V probably null Het
Other mutations in Col8a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00952:Col8a2 APN 4 126309791 missense probably damaging 0.99
IGL01776:Col8a2 APN 4 126309805 unclassified probably benign
IGL03367:Col8a2 APN 4 126312198 missense probably damaging 1.00
R1861:Col8a2 UTSW 4 126311624 unclassified probably benign
R1909:Col8a2 UTSW 4 126312133 missense possibly damaging 0.63
R2866:Col8a2 UTSW 4 126311199 unclassified probably benign
R4013:Col8a2 UTSW 4 126311115 unclassified probably benign
R4586:Col8a2 UTSW 4 126311019 unclassified probably benign
R4995:Col8a2 UTSW 4 126310788 missense probably damaging 0.98
R5160:Col8a2 UTSW 4 126310412 missense possibly damaging 0.77
R5574:Col8a2 UTSW 4 126311268 unclassified probably benign
R5858:Col8a2 UTSW 4 126311300 unclassified probably benign
R6803:Col8a2 UTSW 4 126312000 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TATGGGATGCCAGGAAAACC -3'
(R):5'- AGTCACCTTTCTGTCCTAGGG -3'

Sequencing Primer
(F):5'- TGCCAGGAAAACCAGGACCTAAG -3'
(R):5'- TGTCCTAGGGCTCCTGC -3'
Posted On2014-08-25