Incidental Mutation 'R2038:Dus2'
ID225305
Institutional Source Beutler Lab
Gene Symbol Dus2
Ensembl Gene ENSMUSG00000031901
Gene Namedihydrouridine synthase 2
Synonyms2310016K04Rik, Dus2l
MMRRC Submission 040045-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.615) question?
Stock #R2038 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location105991337-106053840 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 106048662 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 274 (Y274H)
Ref Sequence ENSEMBL: ENSMUSP00000034375 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034375] [ENSMUST00000119736]
PDB Structure
Solution structure of the dsRBD from hypothetical protein BAB26260 [SOLUTION NMR]
Predicted Effect probably damaging
Transcript: ENSMUST00000034375
AA Change: Y274H

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000034375
Gene: ENSMUSG00000031901
AA Change: Y274H

DomainStartEndE-ValueType
Pfam:Dus 15 344 1.8e-54 PFAM
DSRM 370 435 1.03e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000119736
SMART Domains Protein: ENSMUSP00000113781
Gene: ENSMUSG00000031901

DomainStartEndE-ValueType
Pfam:Dus 1 233 8.1e-38 PFAM
DSRM 257 322 1.03e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138524
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144904
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoplasmic protein that catalyzes the conversion of uridine residues to dihydrouridine in the D-loop of tRNA. The resulting modified bases confer enhanced regional flexibility to tRNA. The encoded protein may increase the rate of translation by inhibiting an interferon-induced protein kinase. This gene has been implicated in pulmonary carcinogenesis. Alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, Nov 2012]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022B05Rik T C 8: 124,663,023 Y54C probably damaging Het
9030624J02Rik T C 7: 118,811,874 F677L probably damaging Het
Adgrf4 A T 17: 42,667,863 H196Q probably damaging Het
Astn1 T G 1: 158,657,120 S918A probably benign Het
Cd79a A T 7: 24,899,357 K110N probably benign Het
Cdc34b C T 11: 94,742,288 Q105* probably null Het
Cdh23 T C 10: 60,312,587 D2667G probably damaging Het
Clpx G A 9: 65,317,493 G168R probably damaging Het
Col8a2 T C 4: 126,311,315 probably benign Het
Ddx27 G A 2: 167,033,755 E669K probably damaging Het
Dnah8 A T 17: 30,758,281 I2898F probably damaging Het
Dync2h1 A G 9: 6,967,226 S4073P probably damaging Het
Dynlrb2 G A 8: 116,514,810 R31Q possibly damaging Het
Esyt1 C T 10: 128,511,951 V957I probably benign Het
Fhdc1 A T 3: 84,444,561 L1119Q probably benign Het
H2-T10 T C 17: 36,119,425 K212E probably benign Het
H60b A T 10: 22,286,215 N113I probably benign Het
Hace1 A C 10: 45,700,625 K798Q probably benign Het
Hdac7 C T 15: 97,798,270 R631H probably damaging Het
Kat7 T A 11: 95,300,102 I153F probably benign Het
Lman1 T C 18: 65,998,610 T101A probably benign Het
Mapk8 A T 14: 33,388,936 C245* probably null Het
Mfhas1 T A 8: 35,591,277 W969R probably damaging Het
Mlxipl A T 5: 135,106,999 D26V probably damaging Het
Msh5 A G 17: 35,046,040 V53A probably benign Het
Msl2 C A 9: 101,101,984 A519D probably damaging Het
Nbeal1 A G 1: 60,206,344 S176G probably benign Het
Ninl T A 2: 150,975,843 K134* probably null Het
Olfr1240 C A 2: 89,439,345 M311I probably benign Het
Olfr384 T A 11: 73,603,413 Y278N probably damaging Het
Olfr959 A G 9: 39,572,987 S91P probably damaging Het
Pabpn1 T G 14: 54,897,152 I250S probably damaging Het
Ppp4r4 G A 12: 103,576,280 probably null Het
Rad51ap2 T C 12: 11,457,024 S316P possibly damaging Het
Scn7a C A 2: 66,737,436 W271C probably damaging Het
Set T C 2: 30,070,200 S182P probably benign Het
Sez6l T C 5: 112,472,752 T321A possibly damaging Het
Sfpq A T 4: 127,021,502 H29L unknown Het
Slc33a1 A G 3: 63,948,156 L356P probably damaging Het
Sptbn1 C G 11: 30,159,293 probably null Het
Srrd C T 5: 112,338,450 G179D probably benign Het
Taf4b T C 18: 14,807,399 S312P probably damaging Het
Tgfbrap1 A T 1: 43,054,634 L566* probably null Het
Tln2 T A 9: 67,397,653 M1L probably benign Het
Ttc27 T C 17: 74,856,502 F702L probably benign Het
Vmn2r54 C T 7: 12,629,710 G419R possibly damaging Het
Vps13b A G 15: 35,884,741 S3187G probably damaging Het
Vps13d C A 4: 145,181,115 probably null Het
Zfp568 A T 7: 29,989,082 E23V probably null Het
Other mutations in Dus2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00966:Dus2 APN 8 106025901 splice site probably null
IGL03000:Dus2 APN 8 106048684 missense probably damaging 1.00
IGL03265:Dus2 APN 8 106033791 splice site probably benign
R0400:Dus2 UTSW 8 106048677 missense probably benign 0.08
R0733:Dus2 UTSW 8 106046070 critical splice donor site probably null
R1109:Dus2 UTSW 8 106053482 missense probably benign 0.16
R1190:Dus2 UTSW 8 106044865 missense possibly damaging 0.67
R1296:Dus2 UTSW 8 106053043 missense possibly damaging 0.86
R1819:Dus2 UTSW 8 106051848 missense probably damaging 1.00
R4282:Dus2 UTSW 8 106048654 missense probably benign 0.17
R4621:Dus2 UTSW 8 106030442 missense probably damaging 0.98
R4903:Dus2 UTSW 8 106044805 missense probably benign 0.00
R5922:Dus2 UTSW 8 106053405 missense possibly damaging 0.85
R5997:Dus2 UTSW 8 106046066 missense probably benign 0.14
R7235:Dus2 UTSW 8 106015955 missense possibly damaging 0.83
R7387:Dus2 UTSW 8 106045987 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTGCTGTTCAACATGAGCC -3'
(R):5'- TCAGGGTCAAGTCTGGCTCAAG -3'

Sequencing Primer
(F):5'- CTTACACTTTGTATGACAGCAGGAGG -3'
(R):5'- CAAGTCTGGCTCAAGTCTGCAAG -3'
Posted On2014-08-25