Incidental Mutation 'R2005:Slco6c1'
ID225306
Institutional Source Beutler Lab
Gene Symbol Slco6c1
Ensembl Gene ENSMUSG00000026331
Gene Namesolute carrier organic anion transporter family, member 6c1
Synonyms4933404A18Rik
MMRRC Submission 040014-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.166) question?
Stock #R2005 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location97059038-97128301 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 97081489 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 407 (I407T)
Ref Sequence ENSEMBL: ENSMUSP00000140791 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027569] [ENSMUST00000189547]
Predicted Effect probably damaging
Transcript: ENSMUST00000027569
AA Change: I424T

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000027569
Gene: ENSMUSG00000026331
AA Change: I424T

DomainStartEndE-ValueType
low complexity region 44 55 N/A INTRINSIC
Pfam:OATP 95 654 3e-101 PFAM
Pfam:MFS_1 207 474 6.5e-14 PFAM
Pfam:Kazal_2 497 538 7.4e-10 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000189547
AA Change: I407T

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000140791
Gene: ENSMUSG00000026331
AA Change: I407T

DomainStartEndE-ValueType
low complexity region 44 55 N/A INTRINSIC
Pfam:OATP 93 197 7.4e-12 PFAM
Pfam:MFS_1 99 457 2.2e-15 PFAM
Pfam:OATP 192 638 2.5e-64 PFAM
Pfam:Kazal_2 480 521 2.1e-8 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 G A 12: 118,877,827 A961V probably benign Het
Adcy10 A G 1: 165,525,022 Y475C probably benign Het
Adgrb3 T C 1: 25,111,718 M1145V probably benign Het
Akr1c21 A G 13: 4,574,215 T23A probably damaging Het
Ankrd33b A T 15: 31,297,668 S314R probably damaging Het
Apc T C 18: 34,310,909 probably null Het
Atg9a T A 1: 75,185,991 Q460L probably benign Het
Birc3 C T 9: 7,860,341 C292Y probably damaging Het
Capn5 T C 7: 98,129,363 I350V probably benign Het
Cc2d2a G A 5: 43,726,373 probably null Het
Cdh22 T A 2: 165,180,923 E76V probably damaging Het
Cdh8 T C 8: 99,033,471 probably null Het
Cdkn1b ATTCTTCTTC ATTCTTCTTCTTC 6: 134,921,956 probably benign Het
Cfap54 T A 10: 92,884,768 D2608V unknown Het
Crebrf T C 17: 26,742,883 V318A possibly damaging Het
Cwf19l2 A T 9: 3,430,720 N351Y possibly damaging Het
Cyp2c67 A T 19: 39,643,345 M136K probably damaging Het
Ddx10 A G 9: 53,240,475 probably null Het
Ddx47 A G 6: 135,018,121 N92S probably benign Het
Ddx50 T A 10: 62,640,464 H306L probably benign Het
Dnajc27 A G 12: 4,097,317 T167A possibly damaging Het
Dscam T G 16: 97,038,920 K162N probably benign Het
Eif4h G A 5: 134,627,677 T53I probably benign Het
Elmo2 T C 2: 165,298,279 N332S probably benign Het
Ergic3 A G 2: 156,011,108 N157S possibly damaging Het
F2rl1 G T 13: 95,513,274 R367S probably damaging Het
Fbxo36 G A 1: 84,900,069 A151T probably benign Het
Foxf2 G T 13: 31,626,141 R21L unknown Het
Gmip T A 8: 69,814,043 H269Q probably benign Het
Gng4 T A 13: 13,806,166 V32E probably benign Het
Grm3 T C 5: 9,589,793 Y84C possibly damaging Het
Helz2 C T 2: 181,231,329 R2396H probably benign Het
Icosl A T 10: 78,071,953 M116L possibly damaging Het
Itgb3bp A C 4: 99,814,058 N16K probably benign Het
Kcnt2 A G 1: 140,553,018 M824V probably damaging Het
Mki67 T A 7: 135,698,509 K1599* probably null Het
Mmp25 G A 17: 23,640,242 R144W probably damaging Het
Mmrn1 A T 6: 60,976,084 I450F possibly damaging Het
Mroh2b A T 15: 4,917,158 K480M probably damaging Het
Nbn T A 4: 15,979,351 D445E probably benign Het
Npbwr1 T A 1: 5,916,351 S315C probably damaging Het
Olfr1118 T A 2: 87,309,448 S240T probably benign Het
Olfr1166 A G 2: 88,124,547 L146P probably damaging Het
Olfr378 A T 11: 73,425,239 V248E probably damaging Het
Olfr828 G A 9: 18,815,505 S263L probably benign Het
Pard3b A T 1: 62,144,891 E183D probably benign Het
Pde10a G A 17: 8,929,091 probably null Het
Pdlim2 C T 14: 70,164,779 R296H probably damaging Het
Prdm13 T C 4: 21,685,695 probably benign Het
Rc3h2 T A 2: 37,389,753 K461* probably null Het
Reep2 C T 18: 34,845,621 T117M probably damaging Het
Rhbdd1 A G 1: 82,340,810 N138S probably benign Het
Rnf19a A T 15: 36,241,770 F708I possibly damaging Het
Robo2 G A 16: 73,933,115 H1069Y possibly damaging Het
Rpl9 C T 5: 65,389,535 V112I probably benign Het
Sec16a A C 2: 26,439,080 S974R probably benign Het
Sfrp5 A G 19: 42,198,836 M265T probably benign Het
Skint7 T C 4: 111,984,850 I305T probably benign Het
Slc6a7 T C 18: 61,001,641 D454G possibly damaging Het
Slfn8 A T 11: 83,004,150 M610K probably damaging Het
Spidr A G 16: 16,048,049 S299P probably damaging Het
Sptbn4 C T 7: 27,366,419 W2034* probably null Het
Stard9 T A 2: 120,664,945 F100L possibly damaging Het
Stard9 C A 2: 120,673,636 S221R probably damaging Het
Stc1 T C 14: 69,031,647 probably null Het
Sun2 T C 15: 79,726,624 E667G possibly damaging Het
Tacc2 T C 7: 130,731,550 S511P probably damaging Het
Tasp1 T G 2: 139,977,678 K202Q probably damaging Het
Tdrd6 A G 17: 43,628,655 F501L probably damaging Het
Tgds A G 14: 118,130,656 V35A possibly damaging Het
Tubgcp6 G A 15: 89,104,166 T860I probably benign Het
Twf1 C T 15: 94,585,447 probably null Het
Vangl1 A G 3: 102,163,466 S385P probably benign Het
Vmn2r117 A G 17: 23,477,644 I263T probably damaging Het
Washc5 A G 15: 59,341,155 L892P possibly damaging Het
Wnk4 T C 11: 101,263,890 C302R probably damaging Het
Zfp395 A G 14: 65,388,885 E191G possibly damaging Het
Zkscan17 A G 11: 59,492,216 L302P probably damaging Het
Other mutations in Slco6c1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00547:Slco6c1 APN 1 97087949 missense probably benign 0.00
IGL00571:Slco6c1 APN 1 97087951 missense probably benign 0.04
IGL01483:Slco6c1 APN 1 97128107 missense probably benign
IGL01543:Slco6c1 APN 1 97125828 missense possibly damaging 0.95
IGL01860:Slco6c1 APN 1 97075823 splice site probably benign
IGL03106:Slco6c1 APN 1 97066023 splice site probably benign
R0087:Slco6c1 UTSW 1 97118578 missense probably benign 0.00
R0543:Slco6c1 UTSW 1 97127898 missense probably damaging 0.99
R0674:Slco6c1 UTSW 1 97104773 splice site probably benign
R0826:Slco6c1 UTSW 1 97128101 missense probably benign 0.00
R0928:Slco6c1 UTSW 1 97104848 missense possibly damaging 0.88
R0969:Slco6c1 UTSW 1 97119960 missense probably benign 0.05
R1366:Slco6c1 UTSW 1 97128203 start gained probably null
R1559:Slco6c1 UTSW 1 97098498 missense probably damaging 1.00
R1594:Slco6c1 UTSW 1 97062438 missense probably benign 0.36
R1901:Slco6c1 UTSW 1 97072982 missense probably damaging 0.98
R2101:Slco6c1 UTSW 1 97072870 nonsense probably null
R2102:Slco6c1 UTSW 1 97127931 missense probably benign 0.02
R2120:Slco6c1 UTSW 1 97066083 missense possibly damaging 0.57
R2135:Slco6c1 UTSW 1 97104817 missense probably benign 0.01
R2295:Slco6c1 UTSW 1 97125748 missense probably damaging 1.00
R2437:Slco6c1 UTSW 1 97062476 missense probably benign 0.22
R4004:Slco6c1 UTSW 1 97075885 missense probably damaging 1.00
R4133:Slco6c1 UTSW 1 97081493 missense probably benign 0.02
R4643:Slco6c1 UTSW 1 97062424 missense probably benign 0.00
R4786:Slco6c1 UTSW 1 97087995 missense probably benign 0.04
R4942:Slco6c1 UTSW 1 97081324 missense probably damaging 1.00
R5485:Slco6c1 UTSW 1 97125756 missense probably damaging 1.00
R5573:Slco6c1 UTSW 1 97127931 missense probably benign 0.00
R5810:Slco6c1 UTSW 1 97075873 missense probably damaging 1.00
R6033:Slco6c1 UTSW 1 97081316 splice site probably null
R6033:Slco6c1 UTSW 1 97081316 splice site probably null
R6191:Slco6c1 UTSW 1 97066083 missense possibly damaging 0.57
R6197:Slco6c1 UTSW 1 97072793 critical splice donor site probably null
R6286:Slco6c1 UTSW 1 97125720 missense possibly damaging 0.90
R6404:Slco6c1 UTSW 1 97118605 missense probably damaging 1.00
R6430:Slco6c1 UTSW 1 97075974 missense probably benign 0.43
R6492:Slco6c1 UTSW 1 97125813 missense probably damaging 0.99
R6649:Slco6c1 UTSW 1 97125711 missense probably benign 0.44
R6940:Slco6c1 UTSW 1 97072901 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- AAAAGTAAAGCCATGGTCCATG -3'
(R):5'- CTATTATGAATAAGGCTGCCATGAG -3'

Sequencing Primer
(F):5'- AGCCATGGTCCATGTTTTATATTTC -3'
(R):5'- AGCATAGTGGAGCATGTGTCC -3'
Posted On2014-08-25